Conectarse

Recuperar mi contraseña

Buscar
 
 

Resultados por:
 


Rechercher Búsqueda avanzada

Últimos temas
» Presentando a Ulalá y Aessie y ahora ... SHIVA y JACKIE !!!
Hoy a las 9:34 am por cocio

» No sabemos que tiene hulk
Hoy a las 9:29 am por cocio

» buscando cachorra
Hoy a las 9:28 am por cocio

» Chicho y Cora!!!
Ayer a las 5:39 pm por Ichi

» Perra fawn de compañía
Ayer a las 5:35 pm por Ichi

» CÁNCER DE PÁNCREAS - INSULINOMA
Ayer a las 4:52 pm por VeroParda

» PEPE - 4 años
Ayer a las 4:41 pm por VeroParda

» Presentando a holly
Ayer a las 4:39 pm por VeroParda

» Mi thor-pedo :)
Sáb Ago 19, 2017 11:50 am por gemaiba

» Problemas con el collar isabelino
Sáb Ago 19, 2017 11:15 am por gemaiba

» DOS TOUROS KENNEL - Cachorro Macho
Vie Ago 18, 2017 9:44 am por cocio

» Balder Hasta Pronto Morralucu! † 08/08/2012 - 25/06/2017
Jue Ago 17, 2017 11:59 am por pepe_thefrenchie

» QUIMIOTERAPIA: SÍ O NO?
Jue Ago 17, 2017 10:14 am por cocio

» Glaucoma en el ojo
Miér Ago 16, 2017 8:12 pm por zabalita

» Espartaco de La Virreyna
Miér Ago 16, 2017 8:05 pm por Alscano0314

» otohematoma en mi perra de 11 años
Lun Ago 14, 2017 10:46 am por cocio

» DESERYSHE KENNEL- AFIJO Nº 22561- CATALUÑA (BARCELONA)
Dom Ago 13, 2017 12:22 am por Dos Touros

» DESERYSHE KENNEL- AFIJO Nº 22561- CATALUÑA (BARCELONA) CAMADAS
Jue Ago 10, 2017 9:19 am por cocio

» Soy Sira. Fotos de su evolución.
Mar Ago 08, 2017 5:01 pm por Angeles

» Convivencia con otros perros
Mar Ago 08, 2017 1:03 pm por Angeles

Mejores posteadores
cocio (12201)
 
zabalita (8343)
 
Blade (5065)
 
frankxute_87 (2839)
 
Angeles (2408)
 
Sweet Obsession (2386)
 
lrene (2296)
 
fran-ortu (2057)
 
renesme (1958)
 
Chispa (1833)
 

Agosto 2017
LunMarMiérJueVieSábDom
 123456
78910111213
14151617181920
21222324252627
28293031   

Calendario Calendario


GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Ver el tema anterior Ver el tema siguiente Ir abajo

GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Dom Ago 11, 2013 10:52 am

La genética es un tema que me apasiona, cómo se puede mejorar una raza, eliminando aquellas características no deseadas, cómo se puede conjugar salud y belleza, cómo algunos manazas pasa de ella y crean toda clase de problemas, etc.

No es mi intención aburriros, algunos artículos son bastante complicados, pero para aquellos a quien interese el tema, creo que son fascinantes.

EL CROMOSOMA COMO UNIDAD HEREDITARIA


¿Qué es un cromosoma? ¿Cómo se heredan los genes?
En el organismo, el DNA se empaqueta (se condensa, para ocupar menos espacio) y almacena en los núcleos de las células en unas estructuras llamadas CROMOSOMAS.


En la imagen tenemos esquematizada la estructura de un cromosoma, y cómo se presentan en la célula. Como se puede observar el cromosoma es simplemente una enorme agrupación de DNA, enrollado y comprimido al máximo para que ocupe el mínimo espacio en la célula. Esto es importante, pues el genoma humano, totalmente extendido, tiene una LONGITUD TOTAL DE 1.8 METROS, y eso tiene que caber en cada célula del organismo, de modo que es absolutamente necesario que ocupe el mínimo espacio posible.
Hay que tener en cuenta que el DNA total de un individuo está repartido en los distintos cromosomas que posee, por lo que no está todo “unido”, sino separado en distintas unidades. Esto es importante para entender el proceso de transmisión de los genes desde los progenitores (padres) a los descendientes (hijos), y cómo se generan problemas cuando algo en este proceso de transmisión de la información falla.
Retomando el tema, de estos cromosomas existe en cada célula del organismo una cantidad que es característica de la especie. Por ejemplo, nosotros los humanos tenemos 46 cromosomas (22 parejas y un par de cromosomas sexuales) en nuestras células diploides, y en las células haploides tenemos 23 cromosomas (la mitad). Ahora definiremos los términos haploide y diploide.



La imagen superior muestra un cariotipo humano, es decir, la colección de genes que tiene una célula (en el caso de la imagen, una célula diploide). Los cromosomas se ordenan en los cariotipos en diferentes grupos (A, B, C, D, E, F y G) en función de la longitud relativa de sus “brazos”.
Las células no sexuales (es decir, aquellas que no son espermatozoides y óvulos) tienen dotación doble (repetida) de cromosomas, de modo que tienen una pareja de cada (dotación DIPLOIDE, como en la imagen superior). Cada miembro de esta pareja procede de un progenitor (es decir, uno será de su madre y otro de su padre).
Como hemos dicho, los cromosomas son simplemente DNA superenrollado, y por lo tanto cada cromosoma tiene necesariamente un conjunto de genes concreto que es característico de la especie. Sin embargo, los cromosomas homólogos ("de la pareja") pueden tener diferentes versiones de cada gen que se conocen como ALELOS. Es decir, los genes pueden tener pequeños cambios en su secuencia de nucleótidos que les haga dar lugar a una proteína ligeramente distinta o directamente afuncional (“inútil”), esto es lo que conocemos como “alelos de un gen”.

Veámoslo con un ejemplo práctico y sencillo:
Imaginemos una especie de rosales que dan rosas de color rojo. Un buen día, podando nuestro rosal, nos encontramos una rosa de color blanco. ¿Cómo es esto posible? Lo que puede haber ocurrido es que la enzima (proteína catalítica) crítica para el color de los pétalos haya sufrido una mutación que haya vuelto afuncional, así esa enzima no se genera nunca correctamente y la flor no puede realizar el paso metabólico necesario para conseguir el pigmento de los pétalos. Una versión un poco más compleja que esta es lo que ocurre en la mayoría de los casos de albinismo en el reino animal.
En este caso, tendríamos un gen (el gen que genera la enzima capaz de pigmentar la flor) y dos alelos (posibilidades para ese gen), el alelo “normal”, capaz de generar la enzima que pigmenta de rojo los pétalos, y el alelo “mutante” que da lugar a una enzima aberrante incapaz de llevar a cabo su función. La cosa podría complicarse más con más alelos, por ejemplo, podría haber una versión alélica que fuera menos eficiente que el “alelo normal”, y que por ello pigmentara la flor de rosa en lugar de rojo, porque no es capaz de generar tanto pigmento como el “alelo normal”. Así tendríamos un gen (que genera la enzima pigmentadora) y tres alelos, el normal (pigmenta de rojo), el menos eficiente (pigmenta de rosa) y el mutante (afuncional, no pigmenta).

Continuando con el tema anterior, en los gametos (células sexuales) sólo existe UNA COPIA del cada cromosoma (dotación HAPLOIDE). Esta copia viene por BARAJADO ALEATORIO de las dos que tenía la célula (diploide) de la que se originó el gameto durante la GAMETOGÉNESIS (hablaré de la gametogénesis en otro artículo).
Durante la fecundación, cada una de las células progenitoras (óvulo y espermatozoide) aporta pues UNA COPIA de cada uno de los cromosomas homólogos. Como se puede ver en la imagen. Se ha simplificado imaginando una especie que tiene únicamente dos cromosomas totales en dotación haploide (recordad, los humanos tenemos 23). El óvulo aportaría un “cromosoma 1” y un “cromosoma 2” y el espermatozoide otro “cromosoma 1” y otro “cromosoma 2”. El cigoto resultante sería una célula DIPLOIDE, con dos cromosomas 1 y dos cromosomas 2 homólogos, y cada homólogo procedería pues de un progenitor.



El organismo tiene pues DOS COPIAS HOMÓLOGAS de cada secuencia de DNA, y tiene sus genes POR DUPLICADO. Esto permite que cada gen tenga DOS VERSIONES, una que viene del padre y otra que viene de la madre.
En el organismo cada gen se expresa en un momento y lugar (del cuerpo) concreto dando lugar a una proteína (como veíamos antes en
#0 ).
Las proteínas las fabrica tu organismo. TODAS Y CADA UNA DE ELLAS. Es cierto que tú comes proteínas durante la dieta (las necesitas), pero en el tracto digestivo TODAS ELLAS son separadas en sus componentes básicos (los aminoácidos), y son los aminoácidos lo que la célula utiliza para fabricar sus propias proteínas. No podemos utilizar las proteínas de otras especies para nuestro beneficio.
El organismo es capaz también de fabricar algunos aminoácidos, pero no todos. Existe un grupo de aminoácidos conocidos como "esenciales" que es absolutamente imprescindible adquirirlos por la dieta, pues de lo contrario moriríamos.
No, congénito y genético no es exactamente lo mismo. La definición de congénito es "presente en el momento de nacer". No todas las enfermedades genéticas están presentes desde que uno nace, por ejemplo, la enfermedad de Huntington se presenta normalmente a partir de los 40 años de vida. Y no todas las enfermedades que están presentes al momento de nacer son genéticas, por ejemplo, un autismo derivado de la exposición a mercurio durante el desarrollo embrionario es congénito (el bebé nace con él) pero no genético (no lo hereda de su madre).
Lo que pasa es que habitualmente las enfermedades genéticas son congénitas, un síndrome de Down es congénito (está presente al nacer) y genético (trisomía del cromosoma 21).

Los perros tienen 78 cromosomas en las células diploides (38 parejas y un par de cromosomas sexuales).

Este es el cariotipo de un perro:


La transmisión genética es al azar? Por qué causas puede fallar la trasmisión?
La transmisión es azarosa, por eso NUNCA se puede prever (por ejemplo) si una embarazada va a tener un niño o una niña antes de la fecundación. El reparto de cromosomas es al azar, y es una cuestión fortuita que "te toque" uno u otro. Siempre es una cuestión probabilística.
Hay muchos motivos por los que se puede dar una mala transmisión de la información. Desde problemas que ya tenga el óvulo o el espermatozoide (por ejemplo, puede haber sufrido mutaciones, puede haber perdido cromosomas enteros por una mala meiosis...) hasta problemas en la fecundación, o en la división celular del cigoto. No son cosas habituales, pero puede pasar. Y hay muchos puntos donde puede fallar el proceso.
Por qué se producen las mutaciones genéticas?

Hay muchos motivos por los que se puede producir una mutación genética. Por ejemplo, durante la replicación del DNA (la copia del DNA de la célula, para producir otra célula) las enzimas que se encargan del proceso pueden equivocarse copiando e introducir errores. Sin embargo, la tasa con la que esto pasa es irrisoria, y las células tienen sistemas para minimizarlo al máximo. La tasa de error de la DNA polimerasa copiando DNA (contando con el sistema de reparación de errores) es de 10^-8 (diez elevado a menos ocho), es decir, muy, muy, muy baja.
Las mutaciones se pueden producir también por agentes ambientales, agentes químicos, alimentos... etc. Sin embargo, la mayoría de mutaciones ocurre en las células "somáticas" (es decir, las no sexuales) y por lo tanto no hay peligro de que se trasmitan a la descendencia. Sólo las mutaciones en las células sexuales se trasmiten, por lo que la tasa de mutación en nuestra especie es muy baja, pero necesaria para seguir adaptándonos y evolucionando.

Fuente: Mundo Animalia.
drunken 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Dom Ago 11, 2013 10:54 am

CONCEPTOS PREVIOS. INTRODUCCIÓN A MENDEL

Estaba saliéndome un post demasiado largo con lo de las leyes de la genética, así que os voy a poner esto primero para no mataros con un tostón ilegible. Os dejo unos conceptos previos. Esto os servirá para repasar si os perdéis con la terminología:

- Carácter hereditario: Cualquier característica que posea un organismo y que sea susceptible de ser transmitida de generación en generación.

- Fenotipo: Manifestación física (y, por lo tanto, lo único observable) de los caracteres hereditarios.

- Gen: Factor hereditario que determina una característica biológica de un organismo.

- Genotipo: Constitución genética de un organismo.

- Genoma: Dotación completa de DNA de un organismo.

- Alelo: Cada una de las formas alternativas en las que se puede presentar un gen, contienen información genética ligeramente diferente que actúa determinando el mismo carácter, lo que hace posible la existencia de distintos fenotipos.



- Locus (loci en plural): Lugar específico de un cromosoma donde se localiza físicamente un gen. Por ejemplo, el locus del gen que provoca el albinismo se encuentra en el cromosoma 11 humano, en el brazo largo de dicho cromosoma (cromosoma 11q).

- Variedad o línea pura: Poblaciones donde los descendientes producidos por cruces entre individuos de la misma población siempre manifiestan la misma forma del carácter estudiado.

- Homocigoto: Un organismo que, para un carácter concreto, tiene dos copias del mismo alelo. Por ejemplo, para el grupo sanguíneo una persona puede ser AA, BB o 00 (indicando que ha recibido de su madre y de su padre el mismo alelo).

- Heterocigoto: Un organismo que, para un carácter concreto, tiene dos copias de diferentes alelos. Por ejemplo, en el grupo sanguíneo, aquellos individuos que son A0, B0 o AB son heterocigotos.

- Alelo dominante: Aquel que se expresa en el fenotipo de un individuo heterocigoto. Por ejemplo, en el grupo sanguíneo los heterocigotos A0 son grupo sanguíneo A (que es dominante sobre 0) y los heterocigotos B0 son grupo sanguíneo B (que es dominante sobre 0).

- Alelo recesivo: Aquel que no se expresa en el fenotipo de un individuo heterocigoto. Por ejemplo, en el grupo sanguíneo, para los heterocigotos A0 y B0, 0 es un alelo recesivo, ya que no se manifiesta en el fenotipo (esos individuos son grupo sanguíneo A y B respectivamente).

- Alelos codominantes: Aquellos que se manifiestan a la vez en el heterocigoto. Por ejemplo, para el grupo sanguíneo AB los alelos A y B son codominantes porque ambos se manifiestan en el fenotipo (ninguno domina sobre el otro, a diferencia de lo que pasa con el grupo 0).


Conviene recordar que el fenotipo es consecuencia de la acción de un genotipo determinado en un ambiente concreto, y tanto cambios ambientales como genotípicos podrán afectar drásticamente el fenotipo final. Nunca olvidemos:

FENOTIPO = GENOTIPO + AMBIENTE.



Las experiencias de Mendel. El por qué de su éxito

Es importante entender que aunque la herencia mendeliana sienta las bases de toda la genética que conocemos, la forma en que Mendel propuso la herencia de los caracteres no se cumple siempre. Esto se debe a que los genes no codifican caracteres sino proteínas, y que un carácter concreto puede estar influenciado por las interacciones de cientos de genes, de forma que el resultado final puede ser impredecible.

Mendel tuvo suerte con sus experimentos, y su éxito radica principalmente en la planta que utilizó como sujeto de investigación: el guisante (Pisum sativum). Esto se debe a:


1. Se trata de un organismo de fácil cultivo.
2. Su ciclo biológico es corto (y por lo tanto es rápido obtener descendencia de los cruces).
3. Muy prolífico, los cruces dan un gran número de descendientes.
4. Presenta autopolinización.
5. Es fácil realizar cruces entre diferentes plantas.
6. Disponía de gran variedad de líneas puras para un carácter dado.

Fuente: Mundo Animalia.

drunken 


Última edición por cocio el Dom Ago 11, 2013 11:08 am, editado 1 vez
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Dom Ago 11, 2013 11:06 am

LAS LEYES DE LA GENÉTICA: GREGOR JOHANN MENDEL

El método de trabajo de Mendel consistía en realizar una serie de cruces orientados a obtener una descendencia que posteriormente analizaba, y utilizaba como parentales del siguiente cruce.
Es decir, Mendel cruzaba dos individuos parentales (generación P), analizaba la descendencia de estos parentales (generación F1 –filial 1–), y retrocruzaba la F1 entre sí (cruzaba “hermanos”) para obtener una generación F2 (filial 2) que volvía a analizar.
Durante estos experimentos hizo dos observaciones muy importantes.
a) La generación F1 presentaba homogeneidad fenotípica (todos los individuos eran iguales).
b) En la generación F2 reaparecía el fenotipo parental ausente en la F1, y lo hacía en una proporción aproximada de 1:3.
1. Ley de la uniformidad:
Establece que si se cruzan dos razas puras para un determinado carácter, los descendientes de la primera generación serán todos iguales entre sí fenotípica y genotípicamente, e iguales fenotípicamente a uno de los progenitores (de genotipo dominante), independientemente de la dirección del cruzamiento. (- Esta definición es de la Wikipedia, no es mía).
En es básicamente lo mismo que dice el apartado a) anterior, y veremos por qué con la explicación de la siguiente Ley.
2. Ley de la segregación:
En la imagen podéis ver los apartados a) y b) desarrollados. Cuando Mendel cruzaba una planta con semillas lisas (spherical seed) con una planta de semillas rugosas (dented seed) obtenía una generación F1 homogénea de semillas lisas. Y al retrocruzar la F1 entre sí misma el fenotipo ausente (semillas rugosas) reaparecía en la F2, y lo hacía en una proporción 1:3 (es decir, de cada 4 semillas descendientes 1 era rugosa y 3 eran lisas).




Aunque la aparente proporción fenotípica de 1:3 podría decirse que era 1:2:1 GENOTÍPICAMENTE. Veamos por qué con un “cuadro de Punnet”. La generación parental (P) son líneas puras (es decir, son homocigotos para el carácter).Fuente: Mundo Animalia.


Al cruzar dos líneas puras homocigotas donde un alelo R (semilla lisa) domina sobre otro r (semilla rugosa) obtenemos una F1 homogénea de heterocigotos Rr (semillas lisas). Si esta F1 es cruzada por sí misma, el resultado es:
- Un 25% (1/4) de semillas RR (fenotípicamente semillas lisas), homocigoto dominante.
- Un 50% (2/4 = 1/2) de semillas Rr (fenotípicamente semillas lisas), heterocigoto.
- Un 25% (1/4) de semillas rr (fenotípicamente semillas rugosas), homocigoto recesivo.
Cumpliendo una proporción genotípica 1:2:1, como comentábamos y una proporción fenotípica 1:3. Hay que tener en cuenta que en estos cruces SÓLO ESTÁ IMPLICADO UN GEN, el gen “R” que determina el aspecto de la semilla, y tiene DOS ALELOS, el alelo dominante “R” que determina un aspecto liso y el alelo recesivo “r” que determina un aspecto rugoso. Al SÓLO estar implicado UN GEN estamos hablando de un cruce MONOHÍBRIDO.
Con las observaciones anteriores, Mendel propuso las dos primeras de sus leyes, a las que se conoce como Ley de la Segregación y Ley de la Uniformidad. La Ley de la Segregación postula que los dos miembros de un par génico (es decir, los dos alelos, R y r en el caso de los heterocigotos de la F2) se separan uno del otro en la formación de los gametos (óvulos y espermatozoides) de manera que cada uno de ellos aparece en la mitad de los productos gaméticos.
Efectivamente, si recordáis dijimos que las células sexuales eran haploides (es decir, que sólo tenían una copia de cada cromosoma). Pero provienen de células diploides (con dos copias de cada cromosoma) que, mediante un proceso llamado “meiosis” generan células haploides. Los cromosomas homólogos son repartidos en las células haploides de forma separada, tal y como postula la ley de la segregación.
En la imagen podemos ver un macho heterocigoto para un carácter (Aa) y una hembra heterocigota para dicho carácter (Aa). Como se puede observar el macho puede formar gametos A y gametos a, y la hembra puede formar gametos A y gametos a. La combinación de los espermatozoides y óvulos nos da las posibilidades AA, Aa, Aa y aa, tal como veíamos en los cruces de Mendel. Más adelante, cuando explique la gametogénesis, explicaré también qué es la meiosis (representada como R! en el dibujo) y la mitosis. Así seguramente este punto quedará más clarificado.
3. Ley de la transmisión:
La tercera de las leyes de Mendel se conoce como “Principio de la Transmisión Independiente” y postula que en la formación de los gametos pares génicos diferentes (es decir, GENES DISTINTOS) segregan de manera independiente los unos de los otros. Esta teoría se comprobaba con los experimentos donde Mendel realizaba cruces DIHÍBRIDOS (es decir, cruces donde estaban implicados dos caracteres que a su vez estaban determinados cada uno de ellos por un gen distinto, con dos alelos posibles cada uno de estos genes).
Veámoslo gráficamente:

Esta vez Mendel cruzó una planta homocigota para semillas amarillas y lisas (redondas), cuyo genotipo nos marcan como VVRR con una planta homocigoto recesiva para semillas rugosas y verdes, cuyo genotipo marcan como vvrr. En genética, cuando un alelo se marca en mayúscula implica que es dominante sobre su otro alelo, así que el alelo V (semilla amarilla) sería dominante sobre v (semilla verde). Y el alelo R (semilla lisa) sería dominante sobre el alelo r (semilla rugosa).
En este cruce, entonces, tendremos dos genes. El gen “R”, que determinará la morfología de las semillas, y que tiene dos alelos posibles. El alelo “R”, que marca semillas lisas (y es dominante) y el alelo “r” que marca semillas rugosas (y es recesivo). Además, tenemos el gen “V”, que determina el color de la semilla, y que tiene otros dos alelos, el alelo “V” que determina color amarillo (y es dominante) y el alelo “v” que determina color verde (y es recesivo).
Como vemos, la F1 sale heterocigota (VvRr) y homogénea (semillas amarillas y lisas), cumpliéndose la Ley de la Uniformidad nuevamente. Al cruzar la F1 consigo misma (VvRr x VvRr) obtenemos el cuadro de Punnet superior que vuelvo a repetir aquí:

Cuando combinamos un dihíbrido (como en nuestro caso, VvRr) tenemos que poner todas las posibilidades de gametos a los que pueden dar lugar cada uno de los miembros de la pareja, con lo que lógicamente el cuadro de Punnet tiene más entradas. Veámoslo despacio.
Un individuo dihíbrido puede dar gametos:
- VR (alelo para color amarillo y alelo para semilla lisa).
- Vr (alelo para color amarillo y alelo para semilla rugosa).
- vR (alelo para color verde y alelo para semilla lisa).
- vr (alelo para color verde y alelo para semilla rugosa).
Así hay que hacer cuatro entradas por cada progenitor, y rellenar los cuadros con las combinaciones. Finalmente obtenemos, fenotípicamente, una proporción característica de 9:3:3:1, por separado:
- 9/16 Semillas amarillas y lisas (genotipo V-R-).
- 3/16 Semillas amarillas y rugosas (genotipo V-rr).
- 3/16 Semillas verdes y lisas (genotipo vvR-).
- 1/16 Semillas verdes y rugosas (genotipo vvrr).
Las rayitas (-) en el genotipo, por ejemplo V-R-, implican que da igual el otro alelo, que el resultado será el mismo. Es decir, en V-R- podemos poner 4 genotipos distintos (y todos darían como resultado semillas lisas y amarillas. Estos genotipos serían: VVRR, VvRR, VvRr, VVRr.
Así, las proporciones 9:3:3:1 cumplen la Ley de la Transmisión, porque demuestran que los genes segregan de forma independiente (y por eso pueden hacerse combinaciones como los cuadros de Punnet). Sin embargo, es importante remarcar una cosa: ESTO NO SIEMPRE OCURRE ASÍ.
Tened en cuenta que los genes están físicamente en un cromosoma. Por ejemplo, supongamos que el gen “R” está en el cromosoma 3 y el “V” en el cromosoma 6, entonces sí se cumplirá la Ley de Transmisión de Mendel. PERO si ambos genes están en el mismo cromosoma (por ejemplo, “V” y “R” están en el cromosoma 2) NO SE CUMPLIRÁ, porque la unidad hereditaria es el CROMOSOMA y NO EL GEN, de modo que sufrirán lo que se conoce como LIGAMIENTO. Ahora esto no es importante, en el futuro volveré sobre este punto.

Fuente: Mundo Animalia.


 drunken 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Dom Ago 11, 2013 11:17 am

LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS
¿Por qué es importante entender esto?
Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.
Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.
Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.
Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).
 
¿Qué es un gen molecularmente hablando?
Una mirada hacia atrás: el DNA, ese gran desconocido.
Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).
La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.

¿Cómo es eso posible?
Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:
AAAGCGAGTAGTGGCCATGAC
Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).
¿Interpretamos el código? Fabricando proteínas
Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.
Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:
UUUCGCUCACCGGUACUG
Simplemente:

Donde hay A ponemos U (pues la adenina empareja con uracilo).
Donde hay T ponemos A (pues la timina empareja con la adenina).
Donde hay G ponemos C (pues la guanina empareja con la citosina).
Donde hay C ponemos G (pues la citosina empareja con la guanina).

En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.
Continuemos, ya tenemos el RNA mensajero…

¿De dónde sacamos la proteína?
El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).

La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.
Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):

La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).
Siguiendo el ejemplo anterior, nuestra hebra era:
UUUCGCUCACCGGUACUG
La separamos en grupos de tres codones:
UUU // CGC // UCA // CCG // GUA // CUG
Y miramos qué aminoácido codifican con el código genético. Obteniendo:
Fen – Arg – Ser – Pro – Val – Leu
Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).
Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).
----------------------------
La presencia de estas proteínas puede determinar el estado de un carácter. Hay caracteres raros, que llamamos "monogénicos" o "mendelianos" cuyo estado está condicionado por la presencia del alelo de una única proteína (en el ejemplo de la rosa se proponía así). Aunque en general, como la definición de un carácter es arbitraria, el estado de ese carácter suele estar influenciado por multitud de factores genéticos (alelos de hasta cientos de genes) y de factores ambientales (desarrollo...), un ejemplo de esto es la displasia de cadera. No existe un “gen de la displasia de cadera”, si no que la patología está influenciada por varios genes que determinan la forma del acetábulo y de la cabeza del fémur, y por factores ambientales tales como el desarrollo del perro durante su juventud (si fuerza la extremidad puede agravar la displasia), la obesidad (el peso sobre la cadera agrava las patologías de cadera)… etc.
Es importante quedarse con la idea de que NO HEREDAMOS GENES de nuestros padres sino CROMOSOMAS, y cada cromosoma tiene un conjunto concreto de genes. Así es como sucede que hay enfermedades que se relacionan con ciertas características fenotípicas, porque los genes que las influencian se encuentran en el mismo cromosoma que los genes que dan esas características fenotípicas.


Fuente: Mundo Animalia.
drunken
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Dom Ago 11, 2013 11:37 am




GENÉTICA Y CARACTERÍSTICAS MORFOLÓGICAS
Las características morfológicas son las características visibles. En el perro, incluyen los datos relativos al morfotipo general, el tamaño del animal en la edad adulta, la cabeza, las extremidades, el pelaje e incluso el color de los ojos. Este capítulo no pretende ser un tratado completo de genética aplicada a la cría canina. Existen excelentes obras de síntesis muy bien documentadas sobre este tema, que el lector puede consultar. En estas páginas se ha tratado simplemente de presentar los elementos conocidos que, en el perro, conducen a la aparición de determinadas características morfométricas.
Perfil morfológico general del perro
El perfil de un perro (rectilíneo, convexilíneo o concavilíneo) y sus proporciones (mediolíneo, longilíneo o brevilíneo) permiten apreciar el tipo morfológico general del animal, el cual varía de manera apreciable en la especie canina.
Como indica Bernard Denis, gran especialista francés de genética canina, "la intervención de los factores genéticos exige diferenciar, en la especie canina, el enfoque entre los tipos armónicos y disarmónicos:
- La armonía supone que, a igual peso, partiendo de un tipo medio, representado, por ejemplo, por un Braco (eumétrico, rectilíneo y mediolíneo), se pueda evolucionar paulatinamente, en un sentido, hacia un hipermé trico por la altura, ultralongilíneo y ultraconvexilíneo, como un lebrel (la figura del animal crece, se alarga y se aplana lateralmente), y en el otro, hacia un hipométrico por la altura, ultrabrevilíneo y ultraconcavilíneo, como el Bulldog inglés (la figura del animal se encoge, se acorta y se ensancha lateralmente)
- Hay disarmonía cuando las variaciones no se producen en las direcciones mencionadas: por ejemplo, un perfil ultraconvexilíneo con tronco ultrabrevilíneo (como el Bull terrier) o ultraconcavilíneo con tronco mediolíneo (como el Cavalier King Charles), un tronco sublongilíneo con extremidades cortas (como el Basset artésien normand), etc."
La heredabilidad del tipo morfológico parece ser alta. Este carácter se mejora por selección y no sufre depresión endogámica. En esta transmisión participan efectos poligénicos de acción específica, así como también una acción directa de genes principales.
El tamaño, que engloba la altura y el peso, también parece tener una heredabilidad muy alta. Este carácter se fija genéticamente. La alimentación y, en general, las condiciones de cría sólo son importantes para permitir su expresión más o menos precoz. El aumento del tamaño de algunas razas es estrictamente genético y resulta totalmente imposible hacer crecer un perro mediante medidas nutricionales más allá de lo que determina su potencial genético.
Elementos morfológicos específicos
La cabeza de un perro, elemento fundamental de su "belleza", se relaciona con la genética cuantitativa. El criador debe evitar ciertos excesos. Por ejemplo, tratar de obtener hocicos demasiado largos y finos conduce a menudo a la selección genética involuntaria de animales que padecen prognatismo superior.
Los prognatismos inferior (maxilar inferior saliente) y superior (maxilar superior saliente) parecen trasmitirse de manera autosómica recesiva.
Las anomalías dentarias son variadas y constituyen, según los países, "faltas" más o menos graves. En este plano, sólo se puede afirmar que es más probable encontrar dentaduras defectuosas entre los cachorros de dos progenitores a los que les faltan dientes que en los de dos progenitores con dentaduras normales.
Tampoco se conocen con exactitud los determinantes genéticos relativos a la conformación de las orejas: la forma, la implantación y el porte final parecen ser caracteres cuantitativos, sometidos a efectos poligénicos.
La longitud de las extremidades constituye un buen ejemplo de determinancia genética complejo, en el que intervienen diversos mecanismos:
- efectos poligénicos para el caso general,
- un gen dominante con dominancia incompleta en algunos Bassets,
- un gen recesivo en algunos casos particulares (Cocker y Alaskan Malamute, por ejemplo).
Por último, la forma y el porte de la cola también son cualidades hereditarias y constituyen caracteres étnicos de determinismo poligénico. 92
Características genéticas de las faneras
Entre las características visibles de un perro figura, evidentemente, el pelaje, tanto su color como su textura. En 1991, Costiou y Denis propusieron una nueva nomenclatura para las capas caninas (ver el cuadro anexo). La siguiente descripción está basada en dicha nomenclatura.
La coloración del pelo, la piel y el iris de los perros se deben a un pigmento llamado melanina (pigmento claro cuyo color varía entre el amarillo y el rojo). Este pigmento es responsable de la coloración rojiza del pelaje en caso de deficiencia nutricional de tirosina (síndrome del pelo rojo).
El blanco no tiene existencia propia como color, sino que, en ausencia de pigmento, es el resultado de la presencia de aire atrapado dentro de una matriz sólida translúcida, la corteza del pelo (esto es similar a lo que ocurre con el color "blanco" de la nieve).
Diversos alelos, localizados en distintos loci, pueden participar en:
- la síntesis de eumelanina, en la totalidad o en parte de la piel o el pelo,
- la desviación de esta síntesis hacia la de feomelanina (con una posible interferencia nutricional en caso de carencia relativa de tirosina),
- la inhibición de la formación de pigmentos, en la totalidad o en parte del cuerpo.
Los loci involucrados pueden clasificarse en tres categorías:
- loci determinantes del color de base de la capa,
- loci determinantes de la intensidad de la pigmentación,
- loci supresores de la pigmentación.
Basándose en los trabajos de Denis, se recapitulan a continuación las características genéticas conocidas de la capa, el iris, la nariz y las uñas de los perros.
 


Conclusión
Los riesgos relacionados con las diversas combinaciones genéticas, los fenómenos de dominancia y las mutaciones deben inspirar una gran humildad y una extrema prudencia a los criadores de perros y a los responsables de clubes de raza con respecto a la mejora genética. No obstante, es posible retener los grandes principios de la selección que han sido confirmados por la experiencia y los estudios estadísticos.
- Antes de proceder a la selección, hay que establecer las prioridades, definiendo un pequeño número de caracteres en los que se concentrarán constantemente los esfuerzos
- Una vez definidas las orientaciones de la selección, hay que recordar que los caracteres cualitativos (tipo de pigmento, textura de la capa, etc.) se pueden fijar de manera más rápida y más fácil que los caracteres cuantitativos (características morfológicas, rendimiento, etc.), puesto que dependen de un pequeño grupo de genes.
- Cuando la correlación entre el fenotipo y el genotipo es estrecha, se pueden esperar avances rápidos.
- El apareamiento de dos individuos genéticamente lejanos puede producir, gracias al azar, ejemplares de gran calidad, que serán buenos competidores, pero, por lo general, no serán buenos reproductores (alto grado de heterocigosis).
- En cambio, los cruzamientos consanguíneos no permiten esperar el nacimiento de individuos excepcionales, pero favorecen la fijación de los caracteres, al aumentar la homocigosis.
- Por lo tanto, cuando se quiere introducir una nueva línea de sangre en un linaje, es interesante recurrir a un semental "raceador", de gran capacidad para transmitir sus aptitudes a su descendencia, o, si ello no es posible, a uno de sus hermanos, incluso si éste exterioriza algunos defectos mínimos o tiene una carrera menos importante.
- La mejor práctica de cría consiste en criar simultáneamente varios linajes consanguíneos satisfactorios y realizar de tanto en tanto cruzamientos entre ellos ("line-breeding"), seguidos inmediatamente de cruzamientos consanguíneos si los resultados merecen ser fijados.
- Con el objeto de obtener a largo plazo individuos que presenten todas las cualidades buscadas, algunos criadores realizan de manera prioritaria una selección basada en criterios inversamente proporcionales a la heredabilidad, es decir, primero en función de la fecundidad, luego de la robustez y por último, de las características morfológicas. En efecto, las cualidades de reproducción (salvo la aptitud lechera) son todavía menos heredables que las cualidades de trabajo (determinación muy poligénica), mientras que ciertos caracteres morfológicos, como los defectos congénitos de los aplomos, parecen ser muy heredables.
Fuente: Valdelesabeyes G.R.


Características genéticas de la capa [recapitulación]
 







drunken
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  peqedu el Dom Ago 11, 2013 11:53 am

Un tema que realmente me apasiona, resumido de la forma más esquemática posible, sí señor, me ha encantado cocio
Un saludo

peqedu
Amante del Frenchie
Amante del Frenchie

Mensajes : 64
Edad : 26
Localización : Madrid

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Dom Ago 11, 2013 12:00 pm





MÉTODOS DE SELECCIÓN GENÉTICA
La selección genética consiste en elegir los reproductores para obtener, a más o menos largo plazo, cachorros que satisfagan el objetivo buscado. Los criadores tienen a su disposición diversos métodos para alcanzar este objetivo.
Selección fenotípica
Este método en el que, de manera intencional, no se analizan los antepasados- consiste en aparear dos reproductores de calidad, con la esperanza de obtener cachorros semejantes a ellos. Ahora bien, como se ha visto, el fenotipo no siempre constituye un reflejo del genotipo. Por lo tanto, esta técnica de selección puede tener a veces resultados inesperados. 

Por ejemplo, si un propietario cruza dos perros negros de pelo corto, es posible que espere obtener cachorros semejantes a los progenitores. Sin embargo, si el genotipo de ambos progenitores es Bl/bL, es probable que más del 40 % de los cachorros no concuerden con resultado esperado, como se indica en el cuadro anterior. 

Este método, denominado también selección individual, puede aplicarse cuando el criador todavía está buscando un carácter nuevo y excepcional, fruto del azar. Para limitar su aspecto aleatorio, es posible inspirarse en los resultados experimentales que ya han permitido estimar estadísticamente la heredabilidad de algunos caracteres. 

Cuando se cuenta con las estadísticas del club de raza, es aconsejable trazar una curva que represente, para un carácter cuantitativo definido, el número de perros en función de los diversos valores posibles de dicho carácter. Por ejemplo, si al representar el número de machos de una raza en función de la velocidad de carrera se obtienen dos picos bien definidos, es probable que la población contenga dos linajes distintos y, por lo tanto, que exista un soporte genético de la cualidad considerada. En cambio, si se obtiene una curva gausiana, es decir, con un solo máximo, es preferible no tratar de basar la selección en dicho carácter.

Ejemplo de distribución en típica campana de Gauss, (centrada en la media, de una población de 96 perros adultos de un criadero).
Por ejemplo, si un criador trata de obtener perros de caza excepcionales, puede asignar a los diversos candidatos a la reproducción una nota, determinada a partir de una media de los caracteres que ha definido, ponderados en función de la heredabilidad y, eventualmente, de la importancia que él les atribuye. 

Antes de emprender una selección masal, el criador evalúa entonces cada candidato, asignándole una nota media. Selección genealógica

Partiendo del principio de que "el hábito no hace al monje", este método de selección se basa en la predicción del valor genético de un reproductor a través de la evaluación de sus ascendientes, descendientes y colaterales. 

En efecto, en muchos casos, los estudios genealógicos permiten comprender por qué algunos ejemplares de gran calidad sólo originan individuos mediocres e, inversamente, algunos ejemplares mediocres sólo originan individuos de gran calidad. 

En el primer caso, es probable que un campeón obtenido mediante una selección masal o un apareamiento aleatorio tenga un alto grado de heterocigosis para las cualidades que lo hicieron famoso. Si, además, sus cualidades son recesivas, podrá difícilmente transmitirlas a su descendencia. Su reputación y su carrera se verán rápidamente comprometidas, a pesar de su gran rendimiento técnico. En cambio, cuando un reproductor presenta cualidades raras en forma homocigótica, puede marcar de manera pronunciada su descendencia con estas cualidades, incluso si presenta también algunos defectos recesivos o no hereditarios.


Según J.-F. Courreau
Retomando el ejemplo anterior, si se considera que la capa negra es una cualidad primordial, es evidente que hay que elegir preferentemente reproductores homocigóticos B/B, en vez de heterocigóticos B/b. En este caso, es fácil detectar un semental homocigótico B/B analizando su ascendencia (ausencia de animales de capa marrón en el pedigrí) o su descendencia tras el cruzamiento con una perra b/b o B/b. En efecto, la aparición de un solo animal de capa marrón en la progenie indica la "impureza" del genotipo del semental para el alelo B.

Esto permite comprender el concepto de "pura sangre", aplicable, en las especies canina y equina, a reproductores muy homocigóticos y, por lo tanto, "raceadores", es decir, capaces de transmitir sus aptitudes a su descendencia. Afortunadamente, como la mayor parte de las cualidades son dominantes y la mayoría de los defectos, recesivos, la aparición de defectos se limita a los cruzamientos entre ejemplares heterocigóticos (los animales con defectos en forma homocigótica suelen desecharse para la reproducción). Lo ideal es, evidentemente, utilizar reproductores que presenten todas las cualidades buscadas en forma homocigótica. Es por ello que el método más seguro y más eficaz se basa en los cruzamientos consanguíneos.
Selección genealógica
Partiendo del principio de que "el hábito no hace al monje", este método de selección se basa en la predicción del valor genético de un reproductor a través de la evaluación de sus ascendientes, descendientes y colaterales. 

En efecto, en muchos casos, los estudios genealógicos permiten comprender por qué algunos ejemplares de gran calidad sólo originan individuos mediocres e, inversamente, algunos ejemplares mediocres sólo originan individuos de gran calidad. 

En el primer caso, es probable que un campeón obtenido mediante una selección masal o un apareamiento aleatorio tenga un alto grado de heterocigosis para las cualidades que lo hicieron famoso. Si, además, sus cualidades son recesivas, podrá difícilmente transmitirlas a su descendencia. Su reputación y su carrera se verán rápidamente comprometidas, a pesar de su gran rendimiento técnico. En cambio, cuando un reproductor presenta cualidades raras en forma homocigótica, puede marcar de manera pronunciada su descendencia con estas cualidades, incluso si presenta también algunos defectos recesivos o no hereditarios. 

Retomando el ejemplo anterior, si se considera que la capa negra es una cualidad primordial, es evidente que hay que elegir preferentemente reproductores homocigóticos B/B, en vez de heterocigóticos B/b. En este caso, es fácil detectar un semental homocigótico B/B analizando su ascendencia (ausencia de animales de capa marrón en el pedigrí) o su descendencia tras el cruzamiento con una perra b/b o B/b. En efecto, la aparición de un solo animal de capa marrón en la progenie indica la "impureza" del genotipo del semental para el alelo B.





Esto permite comprender el concepto de "pura sangre", aplicable, en las especies canina y equina, a reproductores muy homocigóticos y, por lo tanto, "raceadores", es decir, capaces de transmitir sus aptitudes a su descendencia. Afortunadamente, como la mayor parte de las cualidades son dominantes y la mayoría de los defectos, recesivos, la aparición de defectos se limita a los cruzamientos entre ejemplares heterocigóticos (los animales con defectos en forma homocigótica suelen desecharse para la reproducción). Lo ideal es, evidentemente, utilizar reproductores que presenten todas las cualidades buscadas en forma homocigótica. Es por ello que el método más seguro y más eficaz se basa en los cruzamientos consanguíneos.





Cruzamientos consanguíneos o endogámicos
Definición

El principio del método de cruzamientos consanguíneos o endogámicos, llamado también endocría (en inglés, in-breeding), es simple: consiste en aparear ejemplares emparentados, con el objetivo de fijar sus cualidades en forma homocigótica.
El grado de consanguinidad de un individuo puede establecerse directamente para tres generaciones a partir del pedigrí. 

La consanguinidad se caracteriza por: 

- el coeficiente de parentesco (100% entre hermanos, 50% para un cruzamiento padre-hija o madre-hijo, 25% entre abuelos y nietos, etc.) 

- el grado de parentesco, que se define mediante el número de generaciones que separa a un individuo de su pariente. Por ejemplo, un grado de consanguinidad 2-3 indica que el ancestro común es abuelo del macho y bisabuelo de la hembra.


Ejemplo de pedigrí

 
Modo de empleo de los cruzamientos consanguíneos
Los cruzamientos consanguíneos permiten fijar caracteres y, por lo tanto, crear un linaje estable a partir de dos individuos emparentados. Ahora bien, esta técnica fija tanto las cualidades como los defectos y, por lo tanto, es importante partir de ascendientes "irreprochables". 

Este método puede revelar la existencia de defectos recesivos, si aparecen cachorros con defectos homocigóticos, que deberán ser excluidos de la reproducción para sanear la población del criadero. 

No obstante, cabe señalar que este método sólo revela defectos genéticos preexistentes en estado latente en el genoma de los reproductores, cuya exteriorización permite además detectar retrospectivamente los portadores heterocigóticos. Así, incluso si la selección puede parecer despiadada, la doble exclusión de los animales defectuosos y de sus progenitores permite que el criador base su producción en individuos genéticamente sanos. Los animales defectuosos desechados para la reproducción pueden ser adecuados para aquellos propietarios que no pretendan utilizarlos como reproductores. 

Retomando el ejemplo de un criador que quiere eliminar de su criadero el color de capa marrón, si aparea dos reproductores negros de genotipo B/b, obtendrá estadísticamente 3/4 de cachorros negros y 1/4 de cachorros marrones en la generación F1. Si excluye de la reproducción los cachorros marrones (b/b) y cruza los perros negros F1 (1/4 B/B y 1/2 B/b) con sus progenitores (B/b), obtendrá normalmente en la generación F2 una camada con un 100% de cachorros negros. Esto le permite entonces detectar los individuos de pura sangre B/B obtenidos en la generación F1, que sólo pueden originar cachorros negros. Esto constituye el principio de los cruzamientos de prueba.
 
Ventajas e inconvenientes de los cruzamientos consanguíneos
 
   El método de cruzamientos consanguíneos permite: 

- revelar y eliminar los defectos genéticos,
 
- fijar en un linaje cualidades satisfactorias para el criador.

Frecuencia de las enfermedades en la población normal los animales consanguíneos, en función del coeficiente de consanguinidad "F" No obstante, no permite crear nuevas cualidades genéticas y es difícil "volver hacia atrás" cuando, por inadvertencia, se ha introducido una alta proporción de caracteres homocigóticos desfavorables.

Este método genera un empobrecimiento genético, un aumento transitorio de la proporción de animales defectuosos, de bajo valor comercial, y, a menudo, una disminución de la fecundidad, debida a la reabsorción de embriones genéticamente no viables (expresión de genes "letales" en forma homocigótica, incompatibles con la vida).

Incluso si la población neófita tiene a veces una opinión negativa del método de cruzamientos consanguíneos, por asimilación a una depuración étnica, la reputación de un criadero está paradójicamente relacionada con la estabilidad de las cualidades obtenidas por este método (reproductores "recomendados" por sociedades caninas). 

Ahora bien, el exceso de cruzamientos consanguíneos puede conducir a la depresión endogámica. Las señales de alerta, como la disminución de la fecundidad y la aparición de otros defectos en una proporción superior al 10%, se observan generalmente hacia la 5ª generación consanguínea e indican al criador que ya es hora de volver a "fortalecer" su linaje con otra "línea de sangre", mediante cruzamientos abiertos.


Cruzamientos abiertos o exogámicos
En este método, también llamado exocría (en inglés, out-crossing), se recurre a otro linaje, en lo posible con alto grado de homocigosis para las cualidades que se quiere introducir en la población del criadero. El objetivo de este cruzamiento es, por una parte, combinar las dos líneas de sangre, y por otra, obtener un beneficio, llamado vigor híbrido o heterosis.
Mediante el análisis del pedigrí del candidato reproductor es posible determinar su grado de consanguinidad y, por lo tanto, de homocigosis. Es posible solicitar al propietario del afijo del semental información sobre las cualidades y el rendimiento técnico de éste y de su progenie. A veces puede ser útil, por motivos de objetividad, ponerse en contacto con los propietarios de la descendencia o de las perras que el semental ha cubierto.
La primera generación obtenida mediante este método (generación F1) presentará probablemente cualidades tan homogéneas como permita el grado de homocigosis. Los cachorros nacidos de este apareamiento serán heterocigóticos y, por lo tanto, si se cruzan entre ellos, no transmitirán a sus descendientes todas sus cualidades. No obstante, serán excelentes ejemplares para la venta. Los mejores individuos deberán permanecer en el criadero, para ser apareados con los perros del linaje anterior o vendidos como sementales al criador del otro linaje, para intercambiar cualidades entre ambos criaderos.
Lo ideal es que cada criador mantenga mediante cruzamientos consanguíneos varios linajes paralelos y los enriquezca periódicamente mediante cruzamientos entre ellos (método de cruzamientos de consanguinidad lejana, llamado en inglés line-breeding).
Fuente: Valdelesabeyes G.R.

 drunken 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Dom Ago 11, 2013 12:30 pm

REPRODUCCIÓN Y SELECCIÓ
* Neonatología Canina
Defectos-Alteraciones Congénitas-Hereditarias

 Definimos defectos o alteraciones congénitas a toda aquella anormalidad de estructura o función presentes en el nacimiento y que pueden ser de origen genético es decir hereditario o no genético debido a un mal desarrollo por una variedad de causas.Los defectos congénitos aparecen como consecuencia de sucesos desorganizados en una o más etapas desde la formación del blastocisto y a lo largo del desarrollo embrionario y fetal. Los defectos o padecimientos hereditarios son puramente de origen genético cuyas incidencias en la descendencia dependen de ciertos patrones de heredabilidad que se expondrán a continuación.
El patrón de heredabilidad de los padres a los hijos de los defectos o alteraciones congénitas de origen genético , pueden ser causadas por un solo par de genes mutantes ,por un único gen mutante o por herencia poligénica en donde intervienen varios pares de genes .El tipo de herencia de estas anormalidades puede ser de carácter autosómico recesivo simple ,es decir tienen que estar presentes dos genes anormales (por ejemplo ,aa) aportados por ambos padres para que se desarrolle la alteración de tal manera que los hijos que posean genes heterocigotos (Aa) serán solo portadores pero no presentaran el padecimiento.
Por el contrario, con la herencia dominante el carácter se presenta con el estado heterocigoto Aa ,de tal manera que los padres anormales pueden producir tanto descendencia normal como afectada lo que facilita la erradicación del problema eliminando del programa de cría a dichos cachorros afectados.
Cuando existe no dominancia o dominancia incompleta, por ejemplo cuando se cruzan perros ligeramente anormales Aa,x Aa ,producen 25% de cachorros normales ,50%ligeramente anormales y 25% severamente anormales.
Cuando un gen no se expresa por él mismo como debería estaremos ante un caso de penetrancia incompleta en donde AA y Aa es dominante expresando ambos resultados idénticos, pero si Aa se comporta como si fuera aa, la penetrancia de Aa es pues incompleta.
La herencia poligénica ocurre cuando un carácter es controlado por un número de genes, cada uno con un defecto relativamente pequeño, mientras que adicionalmente hay factores ambientales que influyen en el carácter en mayor o menor grado como por ejemplo caracteres de conformación.
La herencia por caracteres umbral es controlada por muchos genes que exhiben un estrecho rango de expresión; dependiendo del número de genes implicados hay un umbral en el que la característica cambia de una forma a la siguiente de tal manera que si por ejemplo un conducto debe de estar abierto éste se cierra, entre ellos la criptorquidia o si debe de cerrar se queda abierto como la hernia umbilical o inguinal.
La herencia ligada al sexo indica que cualquier carácter presente en un cromosoma sexual estará asociado al sexo de tal manera que si la anormalidad está presente en el cromosoma X, la madre transmitirá ese mal a toda su descendencia ya sea machos o hembras, pero en el caso del macho solo la transmitirá a sus hijas ya que los machos son XY en donde en Y no está presente la anormalidad.
Un carácter limitado al sexo, es aquel que únicamente se ve en un sexo .por ejemplo la producción de leche se expresa en las hembras pero la herencia está determinada por genes transmitidos por ambos sexos en donde la criptorquidia por ejemplo solo se manifiesta en los machos pero puede ser transmitida por hembras .Los caracteres no están transportados por los cromosomas sexuales X y Y, pero la expresión está limitada a un sexo específico.
Las aberraciones o anormalidades cromosómicas no son muy importantes en el perro ya que normalmente terminan en la pérdida del embrión más que en un defecto congénito.
Causa no genéticas de defectos congénitos
Efecto adversos debidos al medio ambiente en el que se desarrollan los perros son causas no genéticas así como el uso de fármacos no indicados (iatrogenia) o aplicados en etapas no adecuadas como lo es durante la gestación (los fármacos en las hembras gestantes) ,un tratamiento con griseofulvina puede estar asociado en paladar hendido en cachorros ,la administración de progestágenos a la perra en el inicio de la gestación puede causar masculinización de los genitales externos de cachorros hembras con hipertrofia de clítoris .Se cree que el uso de corticoides aumentan el número de cachorros con anasarca en razas braquicéfalas ;así mismo se los ha relacionado con deformidades esqueléticas .Los fármacos anticonvulsivos han sido ligados con defectos cardíacos ,paladar hendido ,microcefalia y otras anomalías esqueléticas.La exposición a radiaciones ,consumo de materiales tóxicos etc.        
Los componentes nutricionales también pueden convertirse en causas no genéticas de defectos congénitos como la hipervitaminosis A ,D ,E y K ,el uso de algunos antibióticos como la trimetoprima ,estreptomicina y las tetraciclinas que producen paladar hendido falta de desarrollo etc.
Tipos de defectos genéticos
La verdadera frecuencia de los defectos congénitos hereditarios no es en realidad bien conocida ,ya que algunas se manifiestan al nacer y otras al crecer el perro de tal manera que no es fácil diagnosticarlas como tales ,unas razas son más propensas que otras a padecerlos ,sin embargo que podamos o no determinarlas ,su incidencia es una realidad ya que algunos autores hablan de su presencia en los perros de raza pura de un 1-2% respecto a defectos severos que amenacen la viabilidad del neonato.Los siguientes cuadros muestran los diferentes defectos hereditarios que se presentan en todas las razas:
Defectos hereditarios del sistema músculo esquelético

Defectos hereditarios del sistema endocrino

Defectos hereditarios del sistema ocular


Defectos hereditarios del sistema sanguíneo y linfático

Defectos hereditarios del sistema cardiovascular  

Defectos hereditarios del sistema nervioso central


Defectos hereditarios del sistema alimentario

Defectos hereditarios del sistema respiratorio

Defectos hereditarios del sistema reproductor-intersexo

Defectos hereditarios del tracto urinario


Por Carlos E. Sorribas. Crianza Canina.
drunken 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:25 am

LA GENÉTICA DEL COMPORTAMIENTO ANIMAL

Un sol anaranjado brillante se está poniendo en el horizonte prehistórico. El cazador solitario vuelve al hogar tras un mal día de caza. Mientras atraviesa la última loma antes de llegar a casa, un movimiento rápido en unas rocas, a su derecha, atrae su atención. Al ir a mirar, descubre unos cachorros de lobo escondidos en una guarida poco profunda. Exclama "¡Huy... qué bueno! El enemigo... en su versión infantil".

Luego de una rápida revisión del lugar para ver si hay lobos adultos, se acerca con cautela. Los cachorros están visiblemente asustados y se amontonan unos contra otros mientras él se arrodilla ante la guarida... todos, excepto uno. El cachorro de pelaje más oscuro no demuestra ningún temor ante el acercamiento del hombre. "¡Ven aquí, pequeño enemigo! Déjame echarte un vistazo", le dice. Tras un intercambio mutuo de caricias del hombre y lamidas del cachorro, el hombre tiene una idea. "Si te llevo a casa conmigo esta noche, quizás mi mujer y mis hijos me perdonen por no haber cazado la cena... otra vez".





INTRODUCCIÓN

Los párrafos antecedentes describen un escenario hipotético sobre el primer hombre que domesticó al lobo. Aunque hemos tratado de poner claridad en este asunto, el hecho es que nadie sabe con precisión cómo o por qué se produjo este primer encuentro. La estimación arqueológica más remota indica que sucedió en el Período Glacial tardío, aproximadamente 14.000 años AC (Boessneck, 1985). Otro escenario sería que los lobos se hayan domesticado a sí mismos. La presunción es que lobos tranquilos, con bajos niveles de miedo, fueron más propensos a alimentarse de carroña cerca de los agrupamientos humanos. Tanto Coppinger y Smith (1983) como Zeuner (1963) sugieren que las especies salvajes que luego fueron domesticadas comenzaron como seguidores de campamentos. Se cree que algunos lobos se alimentaban cerca de los grupos humanos o seguían a las partidas de cazadores; el ganado vacuno salvaje supuestamente invadía los sembradíos, y los felinos salvajes podrían haber incursionado en los graneros en busca de ratones. Sin embargo, las evidencias más recientes, obtenidas mediante secuencias del ADN mitocondrial de 67 razas de perros y lobos de 27 distintos lugares indica que los perros podrían haberse separado de los lobos hace más de 100.000 años (Vita y otros, 1997). En cualquier caso, los lobos convertidos en acompañantes tendrían que haber sido fáciles de tratar y dispuestos a relacionarse con los seres humanos. En el transcurso de unas pocas generaciones, los primitivos humanos podrían haber convertido a los lobos en perros mediante la selección y la crianza de los más mansos. Miles de años atrás, los seres humanos no sabían que el comportamiento animal era heredable. Sin embargo, incluso hoy las personas que crían perros, caballos, cerdos, vacunos o pollos notan que hay diferencias en el comportamiento de las crías. Algunos animales son amistosos y se acercan fácilmente a la gente, mientras que otros son tímidos y nerviosos.

EFECTOS GENÉTICOS DE LA DOMESTICACIÓN

Price (1984) definió la domesticación como un proceso por el cual una población de animales se adapta al hombre y al ambiente de cautiverio mediante una combinación de cambios genéticos, que suceden a lo largo de generaciones, y acontecimientos evolutivos inducidos por el ambiente, que se repiten en cada generación. En experimentos selectivos a largo plazo, diseñados para estudiar las consecuencias de la selección de animales de comportamiento del tipo manso o domesticado, Belyaev (1979) y Belyaev y otros (1981) estudiaron los zorros criados para la producción de pieles. El zorro colorado (Vulpes fulva) ha sido criado en granjas peleteras seminaturales durante más de 100 años, siendo seleccionado por características de su piel, no del comportamiento. Sin embargo, exhiben tres respuestas características distintivas en su respuesta al hombre. El 30% eran extremadamente agresivos hacia el hombre, el 60% eran temerosos o agresivos-temerosos, y el 10% demostraban una reacción exploratoria tranquila, sin miedo ni agresividad. El objetivo de los experimentos era producir animales cuyo comportamiento fuera similar al de los perros domésticos. Mediante la selección y la reproducción de los individuos más mansos, en 20 años el experimento logró convertir zorros salvajes en zorros-perros mansos, del tipo de los Border Collies. La población altamente seleccionada por mansedumbre de estos zorros-perros buscaba activamente el contacto humano, y gimoteaban y movían la cola cuando la gente se les acercaba (Belyaev, 1979). Esta conducta contrastaba totalmente con la de los zorros salvajes, que exhibían una respuesta altamente agresiva y temerosa hacia los seres humanos. Keeler y otros (1970) describieron este comportamiento:

El zorro colorado salvaje (Vulpes fulva) es un manojo de nervios discordantes. Habíamos observado que el zorro colorado, cuando se lo somete por primera vez al cautiverio como adulto, despliega una cantidad de síntomas que se parecen mucho a los observados en casos de psicosis. Se parecen a una amplia gama de fobias, especialmente el miedo a los espacios abiertos, al movimiento, a los objetos de color blanco, a los sonidos, a los ojos, a los anteojos, a los objetos grandes y al hombre. Los animales exhiben pánico, ansiedad, miedo, aprehensión, y una desconfianza profunda en el entorno, que se manifiestan a través de: 1) posturas congeladas, de tipo cataléptico, acompañadas de una mirada perdida; 2) miedo a sentarse; 3) conducta retraída; 4) reacciones de fuga descontrolada, y 5) agresividad. Algunas veces, la tensión del cautiverio hace que se tornen profundamente perturbados y confusos, o les produce un estado de tipo depresivo. En algunos individuos, también se puede observar una excitación o inquietud extrema en respuesta a cambios múltiples en su entorno físico. Poco después de ser capturados, la mayoría de los zorros colorados adultos rompen sus dientes caninos contra las aberturas de nuestros cubículos de metal desplegado, en sus intentos por escapar. En un caso, un zorro recién capturado atacó frenéticamente la puerta de madera de su cubículo hasta caer muerto por agotamiento.

Aunque el estrés de la domesticación es grande, Belyaev (1979) y Belyaev y otros (1981) concluyeron que la selección por mansedumbre era efectiva a pesar de los muchos rasgos indeseables asociados con la mansedumbre. Por ejemplo, los zorros mansos tenían cría en la estación menos conveniente del año, desarrollaban un pelaje negro con rayas blancas y mostraban cambios en su patrón hormonal. Esto significa que su ciclo monoestral (celo una vez al año) se había perturbado, y los animales podían reproducirse en cualquier época del año. Además, hubo cambios de conducta simultáneos a los cambios en la posición de la cola y el perfil de las orejas, y a la aparición del hocico blanco, la raya blanca en la frente y el pelaje blanco en el hombro. El patrón de distribución del pelo blanco en la cabeza es parecido al de muchos animales domésticos (Belyaev, 1979). Los zorros más parecidos a los perros tenían manchas y franjas blancas en la cabeza, orejas caídas y colas alzadas en rulo, y se asemejaban más a los perros que a los zorros que evitaban a la gente. Los cambios en el comportamiento y en la morfología (apariencia externa) también se correlacionaron con cambios en los niveles de las hormonas sexuales. Los zorros mansos tenían niveles más altos de serotonina neurotransmisora (Popova y otros, 1975). La serotonina es reconocida como inhibidora de ciertos tipos de agresión (Belyaev, 1979), y los niveles de serotonina aumentan en el cerebro de quienes consumen Prozac (fluoxetina).

El estudio de la genética del comportamiento puede contribuir a explicar por qué la selección a favor del temperamento calmo se relacionó con cambios físicos y neuroquímicos en los zorros de Belyaev. Los genetistas del comportamiento y los zootécnicos están interesados en entender los efectos que tienen sobre la conducta animal las influencias genéticas y los cambios en el ambiente o en el aprendizaje.

BREVE REVISIÓN HISTÓRICA DEL ESTUDIO DEL COMPORTAMIENTO ANIMAL

Esta revisión histórica no pretende ser exhaustiva; nuestro objetivo es considerar algunos de los descubrimientos previos que tienen importancia para nuestro conocimiento actual del comportamiento animal, con énfasis particular en el tema de la influencia genética en la conducta de los animales domésticos.

En la primera mitad del siglo XVII, Descartes llegó a la conclusión de que "los cuerpos de los animales y los hombres actúan enteramente como máquinas, y se mueven de acuerdo con leyes meramente mecánicas" (citado en Huxley, 1874). Luego de Descartes, otros tomaron la tarea de explicar la conducta como una reacción a sucesos puramente físicos, químicos o mecánicos. Durante los siguientes tres siglos, el pensamiento científico acerca del comportamiento osciló entre la visión mecanicista, según la cual los animales son "autómatas" que se mueven por la vida sin conciencia ni sentido de su propia existencia, y una visión opuesta según la cual los animales tienen pensamientos y sentimientos similares a los de los seres humanos.

En El origen de las especies (1859), las ideas de Darwin sobre la evolución comenzaron a despertar serias dudas acerca de la visión mecanicista del comportamiento animal. Darwin observó que los animales comparten muchas características físicas, y fue uno de los primeros en ocuparse de la variación dentro de una misma especie, tanto en el comportamiento como en la apariencia física. Él creía que la selección artificial y la selección natural estaban íntimamente asociadas (Darwin, 1868), y delineó con gran sagacidad la teoría de la evolución sin tener ningún conocimiento de genética. En El origen del hombre (1871), llegó a la conclusión de que los rasgos del temperamento de los animales son heredados. También creía, como muchos otros científicos de su época, que los animales tienen sensaciones subjetivas y que pueden pensar. Escribió: "Las diferencias entre la mente del hombre y la de los animales superiores, por grandes que sean, son por cierto de grado y no de clase".

Otros científicos se hicieron eco de las implicancias de la teoría de Darwin en cuanto al comportamiento animal, y llevaron a cabo experimentos para investigar los instintos. Herrick (1908) observó el comportamiento de las aves salvajes con el objeto de determinar, primero, cómo se modifican sus instintos por obra de su capacidad de aprender, y segundo, el grado de inteligencia que alcanzan. Respecto del tema del pensamiento animal, Schroeder (1914) concluyó: "La solución, si algún día llega, difícilmente evite ilustrar, si no la mente animal, al menos la del hombre". Para los científicos que estudiaban el comportamiento animal en situaciones naturales, ya era evidente a fines del siglo XIX que el enfoque mecanicista no podía explicar todas las conductas.

El conductismo

A mediados del siglo XX, el pensamiento científico revirtió nuevamente hacia el enfoque mecanicista, y en Estados Unidos se impuso el conductismo. Los conductistas dejaban de lado tanto los efectos genéticos sobre el comportamiento como la capacidad de los animales para adentrarse en soluciones flexibles a los problemas. El fundador del conductismo, J.B. Watson (1930), afirmó que las diferencias en el ambiente pueden explicar todas las diferencias en el comportamiento, y no creía que la genética tuviera efecto alguno sobre la conducta. En The Behavior of Organisms (El comportamiento de los organismos), el psicólogo B.F. Skinner (1958) escribió que todo comportamiento puede ser explicado por medio de los principios de estímulo-respuesta y del condicionamiento operativo. La autora principal entrevistó al Dr. Skinner en la Universidad de Harvard en 1968. Ante una pregunta de ella sobre la necesidad de hacer investigación sobre el cerebro, él respondió: "No necesitamos saber acerca del cerebro, porque tenemos el condicionamiento operativo" (T. Grandin, comunicación personal, 1968). El condicionamiento operativo utiliza recompensas y castigos alimenticios para entrenar a los animales y modelar su comportamiento. En un experimento simple de la caja de Skinner, una rata puede ser entrenada a empujar una palanca para obtener comida cuando se enciende una luz verde, o a presionar muy rápidamente una palanca para evitar un choque eléctrico cuando se enciende una luz roja. La señal lumínica es el "estímulo condicionado". Las ratas y otros animales pueden ser entrenados para cumplir con una secuencia compleja de comportamientos, mediante el encadenamiento de una serie de respuestas condicionadas simples. Sin embargo, el comportamiento de una rata en una caja de Skinner es muy limitado. Se trata de un mundo con muy pocas variantes, y la rata tiene pocas oportunidades de utilizar sus comportamientos naturales. Sólo aprende a empujar una palanca para obtener comida o evitar un choque. Los principios de Skinner explican por qué una rata se comporta de cierta manera en los confines estériles de una caja plástica de 30 cm x 30 cm, pero no revelan mucho sobre el comportamiento de una rata en el basural local. Fuera del laboratorio, la conducta de una rata es más compleja.

Instintos versus aprendizaje

La influencia de Skinner en el pensamiento científico se debilitó en 1961, tras la publicación del artículo "The misbehavior of Organisms" (La inconducta de los organismos), de Breland y Breland. En él se describía cómo los principios skinnerianos chocaban con los instintos. Los Breland eran conductistas de la línea de Skinner, que trataron de aplicar los principios fundamentales del condicionamiento operativo a los animales amaestrados de las ferias y las exhibiciones circenses. Diez años antes de este artículo clásico, los Breland (1951) habían escrito "somos totalmente afirmativos y optimistas en el sentido de que los principios derivados del trabajo de laboratorio pueden ser aplicados al control extensivo del comportamiento animal en condiciones diferentes a las del laboratorio". Sin embargo, para 1961, luego de entrenar más de 6000 animales tan diversos como renos, cacatúas, mapaches, delfines y ballenas para ser exhibidos en zoológicos, museos de historia natural, muestras en grandes tiendas, convenciones de negocios y ferias, y programas de televisión, los Breland escribieron un segundo artículo, que fue publicado en la revista American Psychologist en 1961, en el cual sostuvieron "nuestra preparación en el conductismo no nos había preparado para el choque de algunos de nuestros fracasos". Uno de estos fracasos ocurrió cuando los Breland trataron de enseñar a unos pollos a permanecer quietos durante 10 a 12 segundos sobre una plataforma antes de recibir una recompensa alimenticia. Los pollos se quedaban quietos sobre la plataforma al principio del entrenamiento, sin embargo, una vez que aprendían a asociar la plataforma con la recompensa alimenticia, la mitad de ellos (50%) comenzó a arañar la plataforma, y otro 25% desarrolló otras conductas tales como picotear la plataforma. Los Breland salieron del paso de este desastre al desarrollar una prueba totalmente imprevista, que realizaba un pollo que encendía un aparato de música y bailaba. Comenzaron por enseñarle a los pollos a tirar de un gancho de goma que ponía en marcha una música. Cuando ésta arrancaba, los pollos saltaban sobre la plataforma y empezaban a arañarla y a picotearla hasta que se les entregaba la recompensa alimenticia. La prueba aprovechaba el comportamiento instintivo de los pollos en su búsqueda de alimento. La autora principal recuerda haber visto, en su adolescencia, una prueba similar en la Feria Estadual de Arizona, en la cual una gallina tocaba un piano en un pequeño granero rojo. La gallina picoteaba las teclas de un piano de juguete cuando se metía una moneda de un cuarto de dólar en una abertura, y dejaba de hacerlo cuando le llegaba la comida por una canaleta. Esta prueba funcionaba porque era muy parecida a la caja de Skinner de los ensayos de laboratorio.

Los Breland experimentaron otro fracaso notable cuando trataron de enseñar a mapaches a poner monedas en una alcancía. Dado que los mapaches son propensos a manipular objetos con las manos, esta tarea fue fácil al principio. A medida que el entrenamiento avanzaba, sin embargo, los mapaches comenzaron a frotar las monedas entes de depositarlas en la alcancía. Este comportamiento era semejante al movimiento de lavar, que los mapaches hacían instintivamente para pedir comida. Los animalitos tenían dificultades, al principio, para largar las monedas, y las retenían y frotaban. Cuando los Breland introducían una segunda moneda, los mapaches se hacían casi imposibles de entrenar. Mientras frotaban una moneda contra la otra "de una manera muy avarienta", los mapaches se pusieron cada vez peores a medida que pasaba el tiempo. Los Breland llegaron a la conclusión de que los comportamientos innatos se suprimían en las etapas iniciales del entrenamiento, y a veces, durante buena parte del mismo, pero a medida que éste avanzaba, los comportamientos instintivos para la obtención de alimentos reemplazaban gradualmente a los condicionados. Los animales eran incapaces de superar sus instintos, y entonces ocurría un conflicto entre los comportamientos condicionados y los instintivos.

La etología

Mientras Skinner y sus compatriotas norteamericanos refinaban los principios del condicionamiento operativo trabajando con millares de ratas y ratones, en Europa comenzaba a desarrollarse la etología. Esta consiste en el estudio del comportamiento animal en su ambiente natural, y el interés primario de los etólogos es el comportamiento instintivo o innato (Eibl-Eibesfeldt y Kramer, 1958). Básicamente, los etólogos creen que los secretos del comportamiento se encuentran en los genes del animal y en la forma en que esos genes han sido modificados a lo largo de la evolución para enfrentar entornos particulares. La tendencia etológica se originó en Whitman (1898), quien consideraba a los instintos como reacciones congénitas, que son tan constantes y características de cada especie que pueden tener significación taxonómica, al igual que las estructuras morfológicas. Una opinión similar fue sostenida por Heinroth (1918). Este entrenó pájaros que acababan de salir del cascarón, separándolos de ejemplares adultos de su misma especie, y comprobó que había movimientos instintivos que estas aves hacían sin haber observado a otras, tales como limpiarse las plumas, trinar o rasguñar.

El interés primario de los etólogos es entender los mecanismos y la programación que producen patrones innatos de comportamiento, y las motivaciones por las cuales los animales se comportan de la forma en que lo hacen. Konrad Lorenz (1939, 1965, 1981) y Niko Tinbergen (1948, 1951) catalogaron el comportamiento de numerosos animales en su medio ambiente natural. Juntos desarrollaron el etograma, que es una lista completa de todas las conductas que un animal despliega en su entorno natural. El etograma incluye los comportamientos innatos tanto como los adquiridos. Una contribución interesante a la etología provino de los estudios sobre la conducta de hacer rodar huevos que tiene el ganso gris (Lorenz, 1965, 1981). Lorenz observó que cuando una gansa clueca veía un huevo fuera de su nido, se le desencadenaba un programa instintivo para recuperarlo. La gansa se concentraba en el huevo, se erguía para extender su cuello más allá del mismo, y lo hacía rodar hacia atrás hasta meterlo en el nido. Este comportamiento se desenvolvía de una manera muy mecánica. Si se retiraba el huevo mientras la gansa comenzaba a extender el cuello, igualmente ella completaba el patrón de hacer rodar un huevo inexistente hacia el nido. Lorenz (1939) y Tinbergen (1948) llamaron a esto "patrón fijo de acción". Sorprendentemente, Tinbergen también descubrió que una gansa clueca puede ser estimulada a hacer el trabajo de rodar el huevo con cosas tales como una lata de cerveza o una pelota de béisbol. El patrón fijo de acción de hacer rodar el huevo de vuelta al nido puede ser desencadenado por cualquier cosa que haya fuera del nido que se parezca aun marginalmente a un huevo. Tinbergen constató que las gansas poseen un mecanismo genético de activación de este patrón fijo de acción. Lorenz y Tinbergen denominaron "estímulo señal" al objeto que desencadena la activación de un patrón fijo de acción. Cuando un ave madre ve la boca abierta de sus crías, esto desencadena el comportamiento maternal de alimentarlas, y la madre alimenta a sus crías. La boca abierta es otro ejemplo de estímulo señal, que actúa como un interruptor que enciende un programa determinado genéticamente (Herrick, 1908; Tinbergen, 1951). Los etólogos también explicaron la respuesta innata de escape de los gansos pequeños que recién han roto el cascarón. Cuando éstos son puestos a prueba con una silueta de cartón con forma de halcón que se mueve sobre ellos, esto desencadena una respuesta característica de escape. Los pequeños gansos se agazaparán o correrán. En cambio, cuando la silueta se invierte para que parezca un ganso, no hace efecto (Tinbergen, 1951). Diversos integrantes de la comunidad científica dudaban de la existencia de un instinto tan invariable, pues algunos científicos no lograron repetir los resultados de estos experimentos (Hirsh y otros, 1955). Recientemente, Canty y Gould (1995) replicaron estos experimentos clásicos y explicaron por qué habían fallado los otros. En primer lugar, los gansitos sólo responden a la silueta cuando tienen menos de siete días de edad. Segundo, se debe usar una silueta grande, que haga sombra. Tercero, los gansitos responden a diferentemente la percepción del predador, según las circunstancias. Por ejemplo, las aves sometidas a la prueba individualmente tratan de escapar de la silueta del halcón, y las aves criadas y expuestas en grupos tienden a agazaparse (Canty y Gould, 1995). No obstante ello, la base de la respuesta tiende a ser el miedo. Se ha comprobado que patitos de corta edad tienen una mayor variación en el pulso cardíaco cuando ven la silueta del halcón (Mueller y Parker, 1980).

Investigaciones de Balaban (1997) indican que las vocalizaciones y movimientos de cabeza de los pollos, que son propios de la especie, son controlados por grupos distintos de células cerebrales. Para demostrarlo, Balaban trasplantó células nerviosas de embriones de perdices a embriones de pollos. Los pollos nacidos de los huevos trasplantados tuvieron trinos y movimientos de cabeza típicos de las perdices.

¿Hay patrones fijos de acción similares en los mamíferos? Fentress (1973) dirigió un experimento con ratones, que mostró claramente que los animales tienen patrones de comportamiento instintivo propios de cada especie, que no requieren de aprendizaje. Ratones de un día de vida fueron anestesiados y se les amputó una parte de sus patas delanteras. Se les dejó una parte suficiente de esas patas como para que pudieran caminar con facilidad. Las operaciones fueron realizadas antes de que los ratones tuvieran movimientos plenamente coordinados, de modo que no tuvieron oportunidad para aprender. Cuando estos ratones se hicieron adultos, siguieron teniendo comportamientos propios de su especie, como el movimiento de lavarse la cara. Los ratones normales cierran los ojos justo antes de que las garras pasen sobre su cara, y los amputados también los cerraban antes de que la garra inexistente les tocara la cara. Fentress (1973) concluyó que este experimento demostraba la existencia de instintos en los mamíferos.

La ciencia del comportamiento, hoy

Dos años después del artículo de los Breland, Jerry Hirsh, de la Universidad de Illinois, escribió un artículo (1963) donde ponía énfasis en la importancia de estudiar las diferencias individuales. Según él: "Las diferencias individuales no son por accidente. Son generadas por propiedades de los organismos, que son tan fundamentales para la ciencia de la conducta como las propiedades termodinámicas lo son para la ciencia física". Hoy en día, los científicos reconocen las contribuciones tanto de los enfoques conductistas como de los etológicos para entender el comportamiento. La neurología moderna sostiene la visión darwiniana del comportamiento. Los cerebros de las aves y los mamíferos están construidos con el mismo diseño básico. Todos tienen tronco, sistema límbico, cerebelo y corteza cerebral. Esta es la parte del cerebro que se utiliza para el pensamiento y la solución flexible de problemas. La mayor diferencia entre los cerebros de las personas y los animales es el tamaño y la complejidad de la corteza. Los primates tienen una corteza más grande y compleja que los perros o los cerdos, los cerdos tienen una corteza más compleja que las ratas o los ratones. Además, todos los animales poseen patrones motores innatos y propios de cada especie, que interactúan con la experiencia y el aprendizaje para formar la conducta. Ciertas conductas de los animales, salvajes o domésticos, se rigen básicamente por programas innatos e invariables. Sin embargo, hay otras conductas donde los factores más importantes son la experiencia y el aprendizaje. Un principio básico a tener en cuenta es que los animales con cerebros grandes y complejos se rigen menos por los patrones innatos de conducta. Por ejemplo, el comportamiento de las aves se rige más por el instinto que el de los perros, mientras que un insecto tendrá patrones de comportamiento más invariables. Este principio estaba claro para Yerkes, quien escribió (1905):

Ciertos animales son marcadamente plásticos o voluntarios en su comportamiento, mientras otros son tan marcadamente fijos o instintivos. En los primates, la plasticidad ha alcanzado su mayor nivel conocido de desarrollo; en los insectos, la fijación ha triunfado, la acción instintiva es predominante. La hormiga parece haber sacrificado la capacidad de adaptarse al desarrollo de la capacidad para reaccionar de cierta manera con rapidez, exactitud y uniformidad. A grandes rasgos, los animales pueden ser divididos en dos clases: aquellos que tienen en un alto grado la capacidad de adaptarse inmediatamente a sus condiciones, y aquellos que parecen ser automáticos, pues dependen de sus tendencias instintivas más que en su adaptación rápida.

Sigue ...
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:26 am

INTERACCIÓN DE LA GENÉTICA Y LA EXPERIENCIA

Algunos patrones de conducta son semejantes entre especies distintas, y algunos se encuentran solamente en una especie. Por ejemplo, los programas neurológicos que permiten a los animales caminar son similares en la mayoría de los mamíferos (Melton, 1991). Por otra parte, los rituales de cortejo de las aves son muy específicos a cada especie (Nottebohm, 1977). Algunos patrones innatos de comportamiento son muy rígidos, y la experiencia tiene escaso efecto sobre ellos; otras conductas instintivas pueden ser modificadas por el aprendizaje y la experiencia. El flehmen, que es la reacción de fruncido del labio superior del toro cuando olfatea una vaca en celo, o la reacción de arrodillarse (lordois) que tiene la rata en estro, son ejemplos de comportamientos rígidos. En los mamíferos recién nacidos, la conducta de mamar a la madre es otro caso de sistema de comportamiento muy arraigado. La respuesta de mamar no varía: los mamíferos recién nacidos chupan prácticamente cualquier cosa que se les ponga en la boca.

Un ejemplo de conducta innata que es afectada por el aprendizaje es la construcción de cuevas en las ratas. Boice (1977) descubrió que las ratas de Noruega silvestres y las ratas albinas de laboratorio cavan madrigueras complejas. El aprendizaje tiene algún efecto sobre la eficiencia del cavado, pero la configuración de las cuevas era la misma para las ratas silvestres y las domésticas. Las ratas albinas de laboratorio cavaban excelentes madrigueras la primera vez que se las colocaba en una jaula con piso de tierra. La construcción de nidos por parte de las cerdas paridas es otro ejemplo de interacción entre instinto y aprendizaje. Cuando una cerda tiene su primera parición, muestra un impulso incontrolable de hacer un nido. Se trata de una conducta muy arraigada que responde a cambios hormonales, pues se la puede inducir con inyecciones de prostaglandina F2a (Widowski y Curtis, 1989). No obstante, las cerdas ganan experiencia, con cada parición exitosa, acerca de cómo hacer un mejor nido.

Otros comportamientos son casi totalmente aprendidos. Algunas gaviotas aprenden a arrojar ostras sobre rocas para romperlas y comer su contenido, mientras que otras las arrojan en los caminos para que las rompan los automóviles (Grandin, 1995). Muchos animales, desde los monos hasta las aves, utilizan instrumentos para obtener comida. Griffin (1994) y Dawkins (1993) presentan numerosos ejemplos de animales que exhiben comportamientos aprendidos complejos y soluciones flexibles a problemas.

Las conductas innatas orientadas a obtener alimento, tales como pastorear, buscar carroña o cazar, dependen más del aprendizaje que las conductas usadas para consumir el alimento una vez obtenido. El comportamiento sexual, el anidamiento, las conductas de comer o de matar las presas, tienden a ser regidas más por el instinto (Gould, 1977). Dado que la búsqueda de alimento depende más del aprendizaje, los animales salvajes son más flexibles y pueden adaptarse a distintos medios ambientes. Las conductas usadas para matar o consumir alimentos pueden ser iguales en cualquier ambiente. Mayr (1974) denominó a estos distintos sistemas de comportamiento "abiertos" o "cerrados" a los efectos de la experiencia. Una leona que caza su presa, en una secuencia en la cual la reconoce a la distancia y la acecha cuidadosamente mientras se le aproxima, es un caso de sistema abierto. Herrick (1910) sostiene que "los detalles de la cacería varían cada vez que ella caza; por ende, ninguna combinación de arcos reflejos instalados en el sistema nervioso será adecuado para enfrentar las infinitas variaciones en los requerimientos para obtener alimento".

Interacciones complejas

Algunas de las interacciones entre la genética y la experiencia poseen efectos muy complejos en el comportamiento. En las aves, el pinzón aprende a cantar un trino exclusivo de su especie, incluso cuando se lo cría en una caja insonorizada, donde es incapaz de oír a otras aves (Nottebohm, 1970, 1979). Sin embargo, cuando se permite a los pinzones escuchar el canto de otros pájaros, desarrollan un trino más complejo. El patrón básico del canto del canario emerge aun en ausencia de modelos auditivos de la propia especie (compañeros de bandada) (Metfessel, 1935; Poulsen, 1959). Los canarios jóvenes imitan el canto de los canarios adultos que pueden escuchar, y cuando se los cría en grupos desarrollan patrones de canto compartidos por todos los miembros (Nottebohm, 1977). Muchas aves, como el gorrión de cresta blanca, el pinzón y el loro, pueden desarrollar cantos que equivalen a dialectos locales (Nottebohm y otros, 1976). Los gorriones pueden aprender cantos cuando se les hace oír grabaciones de tonos puros o sobretonos armónicos. Las aves entrenadas con sobretonos armónicos aprenden a cantar canciones con dichos sobretonos, pero pasado un año de aprendidas, el 85% de sus cantos vuelven a los patrones innatos, compuestos de tonos puros (Nowicki y Marler, 1988). Otros experimentos, dirigidos por Mundinger (1995), trataron de determinar la contribución relativa de la genética y el aprendizaje en el canto de los pájaros. Líneas endocriadas de canarios roller y border fueron estudiadas junto con cruzas híbridas de ambas. Además, ejemplares de cada línea fueron criados por hembras de la otra, para controlar los efectos del comportamiento maternal. Los machos de cada línea (roller y border) preferían cantar los patrones de canto innatos, en vez de copiar los de sus tutoras. Los híbridos preferían aprender algo de ambos cantos. Además, los canarios eran capaces de aprender trozos de cantos ajenos a su especie, pero mostraban una preferencia marcada por los propios. Comparando estos animales con los de las pruebas de Breland y Breland (1961), se observa que las aves pueden ser entrenadas para cantar un canto diferente al de su especie, pero los patrones de base genética tienen una fuerte tendencia a imponerse al aprendizaje. En esta revisión bibliográfica, se observa claramente que los patrones innatos pueden ser corregidos en los mamíferos, pero que finalmente los animales tienden a retornar a las conductas innatas.

LA PARADOJA DE LA NOVEDAD

Novedad es todo aquello que es nuevo o extraño en el entorno de un animal. La novedad es una paradoja, porque atrae a la vez que provoca miedo. Esta paradoja se acentúa en aquellos animales que tienen un temperamento nervioso o excitable. Skinner (1922) observó que un animal huidizo, como el antílope americano, se aproximará a una persona echada en el piso sosteniendo una bandera roja. Einarsen (1948) observó también que ciertos animales salvajes se acercan a diversos objetos de gran tamaño que son potencialmente peligrosos, como una pala mecánica. Más recientemente, Kruuk (1972) también constató esta atracción y reacción ante la novedad en las gacelas Thompson del África. En grupos pequeños, las gacelas Thompson están muy alertas a sus predadores (Elgar, 1989). Los animales que subsisten en medios salvajes mediante la fuga están más atentos a las novedades que los animales más plácidos. Las gacelas también pueden distinguir entre un predador peligroso en actitud de caza y otro que no está cazando. Los predadores más peligrosos suscitan los grados más altos de atracción en las gacelas Thompson. A menudo se acercan al leopardo cuando éste no está cazando. Cuando un predador camina a través de una manada de gacelas Thompson, el tamaño de la zona de fuga varía según la especie del predador.

Reacción a la novedad

Confrontados con una novedad súbita, los animales altamente reactivos son más propensos a tener una fuerte reacción de miedo. Los ejemplos de novedad súbita incluyen el ser colocados en una nueva jaula, el transporte en un vehículo extraño, un ruido fuerte inesperado o ser largado en un espacio abierto. Mediante el uso de diversos ambientes experimentales, Hennessy y Levine (1978) descubrieron que las ratas exhiben distintos grados de estrés y niveles de la hormona del estrés, que son proporcionales a cuán novedoso sea el ambiente en que se las coloca. Una jarra de vidrio, por ejemplo, les parece totalmente nueva en comparación con el cubículo de laboratorio al que los animales ya están acostumbrados. Para las ratas, era más estresante ser puestas en una jarra de vidrio que en un cubículo limpio de laboratorio sin paja en el piso.

Reacciones del ganado y las aves de corral ante las novedades

Distintos estudios sobre la reacción de animales de granja ante la novedad han sido dirigidos por Moberg y Wood (1982), Stephens y Toner (1975) y Dantzer y Mormede (1983). Cuando se sitúa a terneros en una pista de pruebas abierta que difiere mucho de sus corrales de origen, exhiben los niveles más altos de estrés (Dantzer y Mormede, 1983). Los terneros criados bajo techo sufrieron más estrés al ser llevados a una pista abierta, y los terneros criados en lugares abiertos sufrieron más estrés al ser llevados a una pista techada. El segundo autor de este artículo ha observado con dolor numerosas reacciones similares en caballos. Cuando los caballos son llevados por primera vez a las montañas, hasta aquellos animales bien entrenados, que están habituados a distintas pistas de exhibición, pueden entrar en pánico al ver una mariposa u oír una rama que se quiebra en una senda de montaña.

Los factores genéticos y la necesidad de novedades

En mamíferos y aves, el desarrollo normal del cerebro y de los órganos sensoriales requiere del contacto con novedades y estímulos sensoriales variados. La investigación de Hubel y Wiesel (1970), que les valió el premio Nobel, demostró que el sistema visual de los gatos recién nacidos sufre un daño irreparable si ellos no reciben estímulos visuales variados durante su desarrollo. Cuando los perros se crían en entornos opacos y carentes de estímulos, son más excitables (Walsh y Cummins, 1975; Melzak y Burns, 1965). Schultz (1965) sostuvo que "cuando la variación en los estímulos es limitada, la regulación central de los umbrales de sensibilidad funcionará a niveles más bajos de estimulación". Krushinski (1960) estudió la influencia de las condiciones aisladas de crianza en el desarrollo de reacciones de defensa pasiva (agresión temerosa) en perros, y encontró que la expresión de reacciones bien definidas de miedo depende del genotipo del animal. Perros de razas Airedale y ovejeros alemanes fueron criados en condiciones de libertad (en hogares) y en aislamiento (en caniles). Este autor descubrió que la reacción de defensa pasiva se desarrollaba más agudamente, y alcanzaba un nivel superior, en los ovejeros alemanes que en los Airedale, criados todos ellos en aislamiento. En general, los animales criados en aislamiento se tornan más susceptibles a los estímulos sensoriales, porque su sistema nervioso procura readaptarse a la carencia previa de estimulación.

En un experimento con pollos, Murphy (1977) halló que los miembros de una línea genética huidiza eran más propensos a entrar en pánico cuando se introducía una pelota en su corral, pero también mostraban más atracción por un alimento nuevo que las aves de líneas genéticas más calmas. Cooper y Zubeck (1958), y más tarde, Henderson (1968) comprobaron que las ratas seleccionadas por su temperamento opaco mejoraban notablemente en el aprendizaje de laberintos cuando se las alojaba en un cubículo lleno de objetos diferentes. Las ratas seleccionadas por su alta inteligencia, en cambio, no respondían mayormente al enriquecimiento del entorno. Grenough y Juraska (1979) constataron que la crianza de las ratas en un medio ambiente pleno de objetos nuevos mejoraba el aprendizaje y aumentaba el crecimiento de sus dendritas o terminales nerviosas del cerebro.

Los cerdos criados en corrales de hormigón también buscan estímulos (Grandin, 1989a y b; Wood-Gush y Vestergaard, 1991; Wood-Gush y Beilharz, 1983). Los cerditos, cuando se les permite elegir entre un objeto conocido y uno nuevo, prefieren al nuevo (Wood-Gush y Vestergaard, 1991). Los cerdos criados en instalaciones de cemento sienten una fuerte atracción por objetos nuevos, a los que manipulan y muerden. La autora principal ha observado frecuentemente que los cerdos de líneas híbridas nerviosas y excitables suelen morder con fuerza las botas y la vestimenta de los operarios. Este comportamiento es menos común en las líneas genéticas de temperamento plácido.

Aunque los cerdos de líneas híbridas sienten una gran atracción por las novedades, si se arroja un objeto nuevo en sus corrales, habrá una fuerte reacción inicial de fuga. En comparación con las líneas genéticas calmas, los cerdos de las líneas híbridas más nerviosas se amontonan unos sobre otros y chillan más cuando se asustan. Los productores de cerdos informan que los porcinos híbridos, nerviosos, de crecimiento rápido y magros, se muerden las colas entre ellos con más frecuencia que los de líneas genéticas más mansas. Esta conducta de comerse las colas también es más frecuente cuando los cerdos están alojados en corrales con piso de hormigón, que les impide hozar.

La autora principal también ha observado esta atracción y reacción ante las novedades en el ganado vacuno. El bovino se aproxima a un pedazo de papel tirado en el piso y lo lame, siempre que pueda hacerlo voluntariamente. En contraste, el mismo pedazo de papel volando al viento puede desencadenar una respuesta masiva de fuga. La experiencia práctica de ambos autores sugiere que los caballos muy reactivos son más propensos a desarrollar vicios tales como morder el comedero o moverse en zigzag cuando se los encierra mucho tiempo en establos en los que no pueden hacer ejercicio. Si se les niega el acceso a la variedad y la novedad en sus entornos, los animales más reactivos se adaptarán peor que los animales pertenecientes a líneas genéticas más tranquilas (Price, 1984).

En resumen, la novedad es algo a la vez temido y buscado, tanto por los animales salvajes como por los domésticos. Lo novedoso se hace más deseable para el animal cuando éste se le puede aproximar lentamente. Cuando los animales son confrontados súbitamente con una novedad, en cambio, ésta les produce miedo.

TEMPERAMENTO

Los factores genéticos influyen sobre las diferencias de temperamento en animales tan distintos como las ratas, los pollos, las vacas, los cerdos y los humanos (Murphey y otros, 1980b; Kagan y otros, 1988; Grandin, 1993b; Fordyce y otros, 1988; Fujita y otros, 1994; Hemsworth y otros, 1990; Broadhurst, 1975; Reese y otros, 1983; Murphy, 1977; Tulloh, 1961; Blizard, 1971). Algunos individuos son cautelosos y temerosos, y otros son calmos y plácidos. Boissy (1995) sostuvo que "la temerosidad es una característica psicológica básica de cada individuo, que lo predispone a percibir y a responder de una forma similar a una amplia gama de sucesos potencialmente temibles". En todos los animales, los factores genéticos influyen sobre las reacciones a situaciones que producen miedo (Davis, 1992; Murphey y otros, 1980b; Kagan y otros, 1988; Boissy y Bouissou, 1995). Por lo tanto, el temperamento está determinado en parte por la respuesta del individuo ante el miedo. Rogan y LeDoux (1996) sugieren que el miedo es el producto de un sistema neural que evolucionó para detectar el peligro, y que hace que el animal genere una respuesta que lo proteja. Plomin y Daniels (1987) hallaron una influencia genética sustantiva en la timidez (temerosidad) de los niños. La conducta tímida en situaciones novedosas es una característica psicológica estable de ciertos individuos. La timidez es considerada, además, como uno de los aspectos más heredables del temperamento humano a lo largo de la vida.

En un experimento diseñado para controlar los efectos maternales sobre el temperamento y la emocionalidad, Broadhurst (1960) dirigió ensayos de crianza adoptiva cruzada con dos corrientes genéticas de ratas, llamadas reactivas a Maudsley (MR) y no-reactivas a Maudsley (MNR). Estas líneas de ratas han sido seleccionadas según sus niveles altos o bajos de reactividad emocional. Los resultados mostraron que los efectos maternales no fueron lo suficientemente fuertes para tapar las diferencias de temperamento de ambas líneas (Broadhurst, 1960). El efecto maternal puede afectar el temperamento, pero no alcanza a cambiar el temperamento de un animal que ha sido criado por una madre de la línea opuesta. En una revisión amplia de la bibliografía, Broadhurst (1975) examinó el papel de la herencia en la formación del comportamiento, y encontró que las diferencias de temperamento entre ratas persisten cuando todos los individuos son criados en el mismo medio ambiente.

La medición de comportamientos basados en el miedo

Un método para poner a prueba la temerosidad es el ensayo a campo abierto (Hall, 1934). La colocación repentina de un animal en una pista de pruebas abierta sirve para medir diferencias en la temerosidad, y ha mostrado diferencias entre líneas genéticas distintas de una misma especie de animales. El piso de la pista de pruebas suele estar marcado con una grilla, a fin de medir cuánto se mueven y exploran los animales. Huck y Price (1975) demostraron que las ratas domésticas son menos temerosas, y caminan más alrededor dela pista abierta que las ratas salvajes. Price y Loomis (1973) explicaron que algunas corrientes genéticas de ratas son menos temerosas que otras, y que exploran más la pista de pruebas abierta que otras. Eysenck y Broadhurst (1964) encontraron que los roedores con alta reactividad emocional eran más temerosos, y que exploran menos el espacio abierto que las líneas genéticas plácidas.

En su estudio de los efectos de la genética en el comportamiento, Fuller y Thompson (1978) concluyeron que "no es suficiente proveer simplemente el mismo ambiente definido y controlado a cada grupo genético. Las condiciones no sólo deben ser uniformes para todos los grupos, sino que además deben ser favorables al desarrollo de la conducta bajo estudio". Por ejemplo, durante la Segunda Guerra Mundial, Krushinski (1960) investigó en la Unión Soviética la aptitud de los perros para recibir entrenamiento para servicios antitanques o como sabuesos preparados para olfatear el rastro de personas. Los perros eran atados a una estaca clavada en el suelo, y la persona que habitualmente los atendía los dejaba darle una lamida al plato de comida y luego los invitaba a seguirlo mientras retrocedía 10 a 15 metros. La actividad del perro era medida con un podómetro durante los siguientes dos minutos. Se descubrió que los perros más activos eran los mejores para el servicio antitanque. Además, no le tenían miedo a nada. En el servicio antitanque, se entrenaba a los perros a acercarse a un tanque y correr al costado o a meterse abajo del mismo. Para hacer esto, los perros debían sobreponerse al miedo natural que les provocaba un tanque moviéndose rápidamente hacia ellos. Los perros menos activos (según la medición del podómetro) resultaron ser los mejores sabuesos: seguían lentamente un rastro y mantenían sus narices cuidadosamente apuntadas hacia el olor que seguían, mientras iban virando a lo largo del rastro. Los perros más activos seguían el rastro demasiado rápidamente, y a veces seguían de largo cuando éste giraba, lo que los hacía cambiar de rastro.

Mahut (1958) demostró un ejemplo de las diferencias de la respuesta al miedo entre dos razas caninas, los beagles y los terriers. Cuando se asustan, los beagles se quedan paralizados, y los terriers corren frenéticamente alrededor. En el ganado doméstico, la medición de las reacciones de miedo durante la inmovilización o en pruebas a campo abierto ha revelado diferencias de temperamento tanto entre razas como entre individuos de una misma raza (Grandin, 1993a; Tulloh, 1961; Dantzer y Mormede, 1983; Murphey y otros, 1980b, 1981). Los animales miedosos y huidizos se agitan más y luchan más violentamente cuando se los sujeta para vacunaciones y otros tratamientos (Fordyce y otros, 1988; Grandin, 1993a). El miedo tiende a ser la causa principal de agitación durante la restricción al movimiento del ganado vacuno, los caballos, los cerdos y los pollos. Los efectos de la genética en la conducta durante el transporte, el manejo y la inmovilización de estos animales son tratados nuevamente en el capítulo 4 de esta compilación.

Diferencias de las especies en la reacción de miedo

En pruebas en espacios abiertos, los roedores asustados tienden a permanecer cerca de las paredes de la pista, mientras que el ganado bovino asustado puede correr en vueltas sin control y tratar de escapar. Los roedores se quedan cerca de las paredes porque temen naturalmente los espacios abiertos, en tanto que los vacunos corren alocadamente en círculos porque temen quedar separados de la manada. Este es un ejemplo de las diferencias entre las especies en su respuesta a una situación atemorizante similar. El miedo puede manifestarse de muchas maneras. Por ejemplo, en una situación, un animal asustado puede correr frenéticamente en vueltas y tratar de escapar, mientras que en otra situación el mismo animal puede quedarse paralizado o limitar sus movimientos. Los pollos suelen quedarse inmóviles cuando son manejados por humanos. Jones (1984) lo denominó "inmovilidad tónica": los pollos están tan asustados que no se pueden mover. En animales salvajes, la captura violenta puede provocarles un ataque cardíaco fatal. Los biólogos de especies silvestres lo llaman "miopatía de la captura". En síntesis, se sabe mucho sobre el complejo fenómeno del miedo, pero sigue habiendo muchas preguntas sin responder.

LA BASE BIOLÓGICA DEL MIEDO

La genética influye sobre la intensidad de las reacciones de miedo. Los factores genéticos aumentan o reducen la reacción de miedo de los animales domésticos (Price, 1984; Parsons, 1988; Flint y otros, 1995). La investigación en seres humanos ha revelado claramente algunos de los mecanismos genéticos que gobiernan la herencia de la ansiedad (Lesch y otros, 1996). LeDoux (1992) y Rogan y LeDoux (1996) afirman que todos los vertebrados pueden ser condicionados a tener miedo. Recientemente, Davis (1992) ha hecho una revisión de estudios sobre la base biológica del miedo. Hay evidencias incontrastables en el sentido de que la amígdala es el centro cerebral del miedo. La amígdala, una pequeña estructura bilateral situada en el sistema límbico, es donde están localizados los detonadores de la reacción de fugar o luchar. Se ha comprobado que la estimulación eléctrica de la amígdala aumenta las hormonas del estrés en las ratas y los gatos (Matheson y otros, 1971; Setckleiv y otros, 1961). La destrucción de la amígdala puede convertir en mansa a una rata salvaje, así como reducir su emotividad (Kemple y otros, 1984). La destrucción de la amígdala también hace imposible provocar una respuesta de miedo en los animales (Davis, 1992). Blanchard y Blanchard (1972) demostraron que las ratas pierden completamente el miedo a los gatos cuando su amígdala está lesionada. Cuando una rata aprende que una señal luminosa significa un choque eléctrico inminente, su respuesta normal es quedarse inmóvil, pero la destrucción de la amígdala elimina esta respuesta (Blanchard y Blanchard, 1972, LeDoux y otros, 1988, 1990). Por último, la estimulación eléctrica de la amígdala desencadena un patrón de respuestas del sistema nervioso autónomo similar al que tienen los humanos cuando sienten miedo (Davis, 1992).

El pulso cardíaco, la presión sanguínea y la respiración también cambian cuando se activa la respuesta de fugar o luchar (Manuck y Schaefer, 1978). Todas estas funciones autónomas cuentan con circuitos nerviosos ligados a la amígdala. Se puede medir el miedo en los animales mediante el registro de la actividad autónoma. En los humanos, Manuck y Schaefer (1978) encontraron tremendas diferencias en la reactividad cardiovascular en respuesta al estrés, lo que refleja una característica genética estable de los individuos.

Temerosidad e instinto

La temerosidad y el instinto pueden contraponerse. Este principio fue observado personalmente por el segundo autor durante su experiencia como criador de perros de la raza Queensland Blue Heeler. La primera parición de la perra Annie fue para ella una experiencia novedosa, porque nunca había visto a otra perra pariendo o amamantando cachorros. Ella se sentía claramente asustada cuando el primer cachorro nació, y era obvio que ella no sabía qué era eso. Sin embargo, ni bien lo olió, su instinto maternal se puso al mando y comenzó a lamerlo de manera constante e incontrolable. Dos años más tarde, una hija de Annie, llamada Kay, tuvo su primera camada de cachorros. Kay tenía más miedo que su madre, y su temperamento muy nervioso fue más fuerte que su programa innato de lamer las crías. Cada vez que uno de sus cachorros nacía, Kay corría alocadamente alrededor de la habitación, sin siquiera acercarse a ellos. El segundo autor tuvo que intervenir y colocar a los cachorros bajo la nariz de Kay, pues de otra manera, podrían haber muerto. El temperamento nervioso de Kay y su temerosidad eran más fuertes que su instinto maternal.

sigue ...
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:27 am

LA REACTIVIDAD DEL SISTEMA NERVIOSO, CAMBIADA POR EL MEDIO AMBIENTE

La crianza de animales jóvenes en entornos despojados, carentes de variedad y de estímulos sensoriales, tendrá efectos en el desarrollo del sistema nervioso. Podrá hacer que el animal sea más reactivo y excitable cuando se convierta en adulto. Este es un cambio persistente, inducido experimentalmente, en la forma en que el sistema nervioso reacciona a diversos estímulos. Los efectos de las privaciones durante el desarrollo temprano también son relativamente persistentes. Melzak y Burns (1965) descubrieron que los cachorros criados en caniles carentes de estímulos se convertían en adultos hiperexcitables. En un experimento, los perros privados de estímulos reaccionaron con "excitación difusa" y corrieron más alrededor de un cuarto que los perros del grupo de control, criados en hogares. La presentación de objetos novedosos también produjo "excitación difusa" en los perros criados en caniles. Además, el electroencefalograma de estos perros siguió dando resultados anormales incluso después de haber abandonado el canil (Melzak y Burns, 1965). Simons y Land (1987) demostraron que la corteza somato-sensorial de los cerebros de ratas recién nacidas no se desarrolla normalmente si se recortan los bigotes a fin de privarlas de insumos sensoriales. La carencia de estos insumos hace que el cerebro sea hipersensible a los estímulos, y los efectos persisten incluso después de que los bigotes hayan vuelto a crecer. El desarrollo de la reactividad emocional del sistema nervioso comienza durante la fase temprana de la gestación. Denenberg y Whimbey (1968) demostraron que el manejo de una rata preñada puede hacer que su descendencia sea más emotiva y explore menos en un espacio abierto que los animales del grupo de control. Este experimento es significativo porque muestra que el manejo de la madre preñada tenía el efecto opuesto en el comportamiento de sus crías. El manejo, y posiblemente el estrés consiguiente en las madres preñadas cambia el ambiente hormonal del feto, lo que resulta en una descendencia más nerviosa. Sin embargo, el manejo de las ratas recién nacidas, tomándolas brevemente y poniéndolas en un contenedor, reduce la reactividad emocional de esas ratas una vez que se convierten en adultas (Denenberg y Whimbley, 1968). Las ratas expuestas a este manejo desarrollan temperamentos más calmos.

Es sabido que las glándulas adrenales tienen efectos sobre el comportamiento (Fuller y Thompson, 1978). Las porciones internas de las adrenales segregan las hormonas adrenalina y noradrenalina, mientras que la corteza externa segrega las hormonas sexuales andrógenas y estrógenas (hormonas reproductivas), y varios corticoesteroides (hormonas del estrés). Yeakel y Rhoades (1941) descubrieron que las ratas emotivas de los estudios de Hall (1938) tenían glándulas adrenales y tiroides más grandes que las ratas no-emotivas. Richter (1952, 1954) encontró que en las ratas noruegas la domesticación iba acompañada de una disminución en el tamaño de las adrenales. Desde estos primeros estudios, se ha descubierto que existen varias diferencias según líneas y corrientes genéticas. Más adelante, Levine (1968) y Levine y otros (1967) encontraron que un manejo breve de las ratas recién nacidas reduce la respuesta de la glándula adrenal al estrés. Denenberg y otros (1967) concluyeron que el manejo temprano puede llevar a cambios importantes en el sistema neuroendócrino.

Cambios en la reactividad vs. domesticación

Las ratas adultas salvajes pueden ser domesticadas y acostumbrarse al manejo por parte de la gente (Galef, 1970). Este es un comportamiento estrictamente aprendido. El amansamiento de animales salvajes adultos, para que se acostumbren al manejo de las personas, no disminuirá su reacción a los estímulos novedosos súbitos. Este principio quedó demostrado por Grandin y otros (1994) durante el entrenamiento de antílopes salvajes en el Zoológico de Denver para la extracción de muestras de sangre sin provocarles altos niveles de estrés. Los nyala son antílopes africanos dotados de una respuesta instantánea de fuga que usan para escapar de sus predadores. Durante su manejo para los tratamientos veterinarios en los zoológicos, los nyala sufren a menudo altos niveles de estrés, llegando al extremo de entrar en pánico y lesionarse a sí mismos. Durante un período de tres meses, Grandin y otros (1995) entrenaron a los nyala a ingresar a una casilla y quedarse quietos para los estudios de sangre mediante el suministro de premios alimenticios. Cada paso nuevo en el entrenamiento debía ser dado lenta y cuidadosamente. Se necesitaban diez días para habituar a los nyala al sonido de cierre de las puertas de la casilla.

Todo el entrenamiento y el tratamiento cariñoso de los cuidadores del zoológico no habían alterado la respuesta de los nyala a los estímulos súbitos y novedosos. Cuando vieron a un operario que reparaba el techo del galpón, reaccionaron repentinamente con una respuesta fuerte de miedo y atropellaron una cerca. Se habían acostumbrado a ver gente en el perímetro de las instalaciones, pero la gente en el techo fue una novedad muy atemorizante. Los movimientos súbitos, tales como alzar una cámara fotográfica para sacar una foto, también hacen que los nyala huyan.

Animales domésticos vs. salvajes

Las especies salvajes de manada exhiben respuestas de miedo ante las novedades repentinas mucho más fuertes que los rumiantes domésticos como los vacunos y los ovinos. Los rumiantes domésticos han atenuado sus respuestas de fuga debido a los años de crianza selectiva (Price, 1984). Los rumiantes salvajes en cautiverio aprenden a adaptarse, y asocian a la gente con la comida, pero cuando se asustan por algún estímulo súbito son muy propensos a entrar en pánico y a lesionarse a sí mismos (Grandin, 1993b, 1997). Esto es particularmente probable si están impedidos de huir por alguna cerca o barrera física. Los principios para el entrenamiento y el manejo son similares para todos los animales de manada. Los procedimientos de entrenamiento utilizados con los huidizos antílopes o las plácidas ovejas domésticas son los mismos. La única diferencia es el tiempo que se requiere. Grandin (1989c) lo demostró entrenando a ovejas Suffolk, muy tranquilas, a entrar en un dispositivo para voltearlas de costado, trabajo que le tomó una tarde, mientras que los nyala le exigieron tres meses de entrenamiento.

En síntesis, la experiencia puede afectar el comportamiento en dos maneras básicas: mediante el aprendizaje convencional o mediante el cambio de la reactividad del sistema nervioso. Lo más importante es que las condiciones ambientales (ricas vs. carentes de estímulos) tienen un impacto muy grande en el sistema nervioso de los animales de corta edad.

LA NEOTENIA

La neotenia es la retención de rasgos juveniles por parte del animal adulto. Los factores genéticos influyen sobre el nivel de neotenia de los individuos. Esta se manifiesta tanto en la conducta como en el físico. En su prólogo a The Wild Canids (Los caninos salvajes) (Fox, 1975), Konrad Lorenz aporta algunas observaciones sobre la neotenia y los problemas de la domesticación:

Los problemas de la domesticación han sido para mí una obsesión durante muchos años. Por un lado, estoy convencido de que el hombre debe la persistencia a lo largo de su vida de su curiosidad constitutiva y de su orientación juguetona a la exploración a una neotenia parcial que es indudablemente una consecuencia de la domesticación. De una manera curiosamente análoga, el perro doméstico debe su ligazón permanente a su amo a una neotenia del comportamiento, que le impide la búsqueda del liderazgo de la jauría. Por el otro lado, la domesticación puede causar una desintegración igualmente alarmante de rasgos de comportamiento valiosos, así como una exageración no menos alarmante de rasgos menos deseables.

Las características infantiles de los animales domésticos son analizadas por Price (1984), Lambooij y van Putten (1993), Coppinger y Coppinger (1993), Coppinger y Scheider (1993) y Coppinger y otros (1987). Un ejemplo es el acortamiento del hocico en los perros y los cerdos. Los animales domésticos han sido seleccionados en favor de un perfil juvenil de la cabeza, hocico corto y otros rasgos (Coppinger y Smith, 1983). Además, la retención de rasgos juveniles hace que los animales sean más tratables y fáciles de manejar. Los cambios físicos también se relacionan con cambios en el comportamiento.

Los estudios genéticos señalan al lobo como el antepasado del perro doméstico (Isaac, 1970). Durante el proceso de domesticación, los perros han conservado muchos comportamientos propios de los lobitos. Por ejemplo, los lobitos ladran mucho, pero los lobos adultos rara vez lo hacen. Los perros domésticos ladran mucho (Fox, 1975; Scott y Fuller, 1965). Los lobos tienen patrones de comportamiento instintivo muy arraigados, que determinan la dominancia o la sumisión en sus relaciones sociales. En los perros domésticos, las pautas ancestrales de conducta social del lobo aparecen de modo fragmentario e incompleto. Frank y Frank (1982) observaron que la rígida conducta social del lobo se desintegraba en "una colección de fragmentos independientes de comportamiento". Los perros de tiro para los trineos, criados junto con cachorros de lobos, no logran captar las señales de comportamiento social de los lobitos. Otras comparaciones demostraron que el desarrollo físico de las habilidades motrices es más lento en los perros de tiro para trineos. Goodwin y otros (1997) estudiaron diez razas distintas de perros, que iban desde los ovejeros alemanes y huskies siberianos hasta los bulldogs, los cocker spaniels y los terriers. Encontraron que las razas que retenían el mayor repertorio de conductas sociales propias de los lobos eran aquellas que se parecían físicamente a los lobos, como los ovejeros alemanes y los huskies siberianos. Tanto Barnett y otros (1979) como Price (1985) concluyeron que la experiencia también puede hacer que los animales retengan rasgos juveniles. Gould (1977) también consideró los efectos de la neotenia y afirmó que ella está determinada por cambios en unos pocos genes que dirigen la secuencia temporal de las distintas etapas de desarrollo.

LA SELECCIÓN EXCESIVA EN FAVOR DE RASGOS ESPECÍFICOS

En la bibliografía médica existen innumerables ejemplos de los graves problemas que causa la selección continua en favor de un rasgo aislado (Steinberg y otros, 1994; Dykman y otros, 1969). La gente que tiene experiencia en la crianza de animales sabe que el exceso de selección en favor de un solo rasgo puede arruinarlos. Los buenos criadores de perros lo saben. Algunas veces, hay rasgos que no parecen estar vinculados pero que en realidad lo están. Wright (1922, 1978) lo demostró claramente mediante la selección continuada por el color del pelo y los patrones del pelaje en corrientes endocriadas de cobayos. Todas las corrientes sufrieron una depresión en la capacidad reproductiva. Además, se produjeron diferencias de temperamento, conformación corporal, tamaño y forma de los órganos internos. Belyaev (1979) también demostró que la selección continuada de zorros en favor de un temperamento calmo tuvo como resultado efectos negativos en el comportamiento maternal y problemas neurológicos. Los experimentos con zorros comprobaron que había cambios graduales en muchos rasgos a lo largo de muchos años de selección continuada de animales de carácter manso. Los problemas fisiológicos y de comportamiento aumentaban en cada generación sucesiva. De hecho, algunas de las zorras más mansas desarrollaron una conducta maternal anormal y se comían sus propias crías. Belyaev y otros (1981) denominaron a esto "selección desestabilizante", en contraste con la "selección estabilizante" que se encuentra en la naturaleza (Dobzhansky, 1970; Gould, 1977). La bibliografía médica veterinaria provee innumerables ejemplos de estructuras óseas anormales y de otros defectos fisiológicos causados por la sobre-selección dentro de las razas caninas sobre la base de la apariencia externa (Ott, 1996). Las anomalías abarcan desde los problemas respiratorios de los bulldogs a los problemas de cadera de los ovejeros alemanes. Scott y Fuller (1965) informaron sobre los efectos negativos de la selección continuada en favor de determinada forma de la cabeza en la raza Cocker Spaniel:

En nuestros experimentos, partimos de las que se consideraban buenas corrientes de sangre, que contaban con un buen número de campeonatos en su linaje. Cuando cruzamos a estos animales con sus parientes cercanos por una o dos generaciones, cada raza puso de manifiesto graves defectos... Los Cocker Spaniels son seleccionados por una frente ancha, con ojos prominentes y un tope o ángulo pronunciado entre la frente y la nariz. Cuando examinamos los cerebros de algunos de estos animales durante su autopsia, encontramos que exhibían un grado leve de hidrocefalia; es decir que, al seleccionar por la forma del cráneo, los criadores habían seleccionado accidentalmente en favor de un defecto cerebral en algunos individuos. Además de todo esto, en la mayoría de las corrientes sólo un 50 por ciento de las hembras era capaz de criar camadas normales y saludables de cachorros, incluso bajo condiciones de cuidado casi ideales.

Lazos entre los distintos rasgos

Los animales que tienen un rasgo de hipertrofia conocido como doble músculo poseen un temperamento más excitable (Holmes y otros, 1972). La doble musculatura es un desarrollo anormal extremo, que puede tener un efecto sobre el temperamento opuesto al de la musculatura normal. Otro ejemplo de rasgos aparentemente inconexos que resultan asociados es la sordera en perros de raza Pointer seleccionados por su carácter nervioso (Klien y otros, 1987, 1988).

Parece haber una relación entre termorregulación y agresividad. Los ratones silvestres seleccionados por su agresividad utilizaban cantidades mayores de algodón para construir sus nidos que sus compañeros de menor agresividad (Sinyter y otros, 1995). Este efecto se verificó con corrientes de ratones de laboratorio tanto como en las silvestres. Los investigadores que utilizan procedimientos genéticos de alta tecnología, que les permiten descartar genes individuales, han sido derrotados hasta ahora por la complejidad de las interacciones genéticas. En estos procedimientos, algunos genes son excluidos mediante técnicas que los detectan y se les impide cumplir con su función normal. Estos experimentos han mostrado que el bloqueo de distintos genes puede tener efectos inesperados en el comportamiento. En un caso, la desactivación de los genes del aprendizaje produjo ratones ultra-agresivos (Chen y otros, 1994). Los ratones mutantes tenían poco o nada de miedo, y se peleaban hasta quebrarse el lomo. En otro experimento, las hembras mutantes exhibían un comportamiento normal hasta que tenían cría, y allí se desinteresaban totalmente por su descendencia (Brown y otros, 1996). En un tercer experimento, Konig y otros (1996) anularon el gen que produce la encefalina (una sustancia cerebral opioide) y se encontraron con resultados imprevistos. La encefalina es una sustancia ligada normalmente a la percepción del dolor; sin embargo, los ratones que tenían deficiencia en esta sustancia eran muy nerviosos y ansiosos. Corrían frenéticamente alrededor de sus cubículos en reacción a los ruidos. La conclusión final de varios experimentos de anulación de genes es que el cambio en un gen tiene efectos imprevisibles en otros sistemas. Los rasgos están ligados, y quizás sea imposible aislar completamente los efectos de un único gen. Los investigadores señalan que se debe ser cuidadoso y no saltar a conclusiones en el sentido de que se ha descubierto "el gen de la agresión", "el gen maternal" o "el gen de la ansiedad". Para utilizar una analogía de la ingeniería, no se puede concluir que se ha encontrado el "centro de la imagen" de un televisor porque se ha cortado un circuito interno y la imagen ha desaparecido. Gerlai (1996) y Crawley (1996) también alertan que la neutralización del mismo gen en dos especies diferentes puede tener distintos efectos en el comportamiento. Esto se debe a las interacciones complejas que hay entre muchos genes distintos. Hace veinte años, los genetistas del comportamiento llegaron a la conclusión de que la herencia de la conducta es un proceso complejo. Fuller y Thompson (1978) concluyeron que "se ha encontrado reiteradamente que ningún mecanismo genético da cuenta de un tipo particular de comportamiento".

Factores aleatorios

Los genetistas de la conducta han descubierto que es imposible controlar totalmente la variación en algunos rasgos. Gartner (1990) descubrió que la crianza de líneas endocriadas genéticamente similares no alcanzaba a controlar las variaciones en el peso. Incluso bajo condiciones de laboratorio, altamente estandarizadas, los pesos corporales siguieron fluctuando en los distintos individuos. Los criadores porcinos también han observado que las líneas híbridas producidas comercialmente no tienen la misma tasa de ganancia de peso. Hay factores aleatorios desconocidos que afectan la variabilidad incluso en animales genéticamente idénticos. Una causa pueden ser los factores intrauterinos; las otras causas son desconocidas. Darrel Tatum y sus alumnos de la Colorado State University encontraron variaciones en la conformación corporal y en la calidad de la carne de ganado que era 50 % británico (Bos taurus) y 50 % índico (Bos indicus). Algunos animales tenían más características índicas, con gibas más grandes y orejas más largas, y la conformación corporal de muchos animales no era mitad británica y mitad índica. Las características de la carne también variaban, y los animales que parecían más índicos tenían carne más dura. Los animales tenían una variación de alrededor del 10% respecto de la conformación corporal y las características de la carne de las cruzas índicas de media sangre.

Gartner (1990) concluyó que hasta un 90 % de las causas de la variabilidad aleatoria no puede ser explicada por diferencias en el medio ambiente físico del animal. Tanto en ratones como en vacunos, los factores aleatorios afectan los pesos corporales. Gartner (1990) cree que los factores aleatorios pueden tener influencia ya sea antes o apenas después de la fertilización. Las interacciones entre los factores ambientales y los genéticos son complejas. Tanto la conformación genética del animal como su ambiente determinan la forma en que se comportará. Estas interacciones serán tratadas con mayor detalle en capítulos subsiguientes de esta compilación. La genética tiene profundos efectos sobre el comportamiento de un animal.

CONCLUSIONES

Existe una compleja interacción entre los factores genéticos y ambientales, que determina la forma en que se comportará un animal. Otro principio es que los cambios en un rasgo, como el temperamento, pueden tener efectos imprevistos en otros rasgos aparentemente desvinculados. La sobre-selección en favor de un único rasgo puede terminar en cambios indeseables en otros rasgos de comportamiento y de conformación física.

Por Temple Grandin y Mark J. Deesing. Departamento de Ciencia Animal. Colorado State University.

Traducción del Dr. Marcos Giménez-Zapiola .
drunken
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:33 am

ERRADICAR LAS MUTACIONES: Un sueño imposible

Aunque no se puedan erradicar todas las mutaciones nocivas, sí que se puede reducir de forma significativa el número de individuos afectados, combinando una cría inteligente y el desarrollo de los tests de ADN.
¿Por qué hay mutaciones?
Las mutaciones son modificaciones en el ADN de un organismo que pueden afectar el funcionamiento correcto de un gen. Éstas sobrevienen de forma natural a causa de errores en la replicación, de apareamientos fallidos de cromosomas homólogos, o por una exposición inevitable a radiaciones naturales, por ejemplo, rayos cósmicos. Una mutación puede aparecer en cualquier lugar en al ADN y en cualquier célula. Sólo son hereditarias cuando esto ocurre en las células germinales (óvulos y espermatozoides), pero mutaciones en el ADN de otras células (somáticas) podrían inducir un cáncer. Incluso si los enzimas que participan en la replicación del ADN cumplen su cometido con gran precisión, y habiendo también mecanismos suplementarios para detectar y corregir anomalías, ningún sistema es perfecto. Debemos reconocer entonces, que cierto nivel de mutación es inevitable. No obstante, la tasa de mutación aumenta por los efectos de la radiación, incluida la ultravioleta, y la exposición a ciertos elementos químicos tóxicos. Por tanto, podemos tomar algunas medidas de precaución y así minimizar el riesgo.
La tasa de mutación en los perros no se puede determinar fácilmente, pero sobre la base de evidencias indirectas y por extrapolación con otras especies, los genetistas creen que estas tasas de mutación son normalmente del orden de 1 sobre 100.000, o menos. Para un mamífero, esto significa que una nueva mutación en un gen concreto ocurre una vez por cada 100.000 gametos. Esto puede parecer que no sea una probabilidad muy alta, pero considerando que la mayoría de mamíferos se estima que tienen entre 80 y 100.000 genes. Esto sugiere que cada individuo que nace tiene una gran posibilidad de tener una nueva mutación en algún gen.
¿Qué pasa con las nuevas mutaciones?
Es muy poco probable que una mutación idéntica aparezca simultáneamente en el mismo gen que se ha heredado del padre y de la madre (probabilidad de <1 sobre 10.000 millones), así que los descendientes serán heterocigotos (a excepción de los genes ligados al sexo, ya que los cromosomas X e Y no son homólogos). Las mutaciones dominantes se expresarán y la que sea nociva será eliminada casi inmediatamente de la población. Si la mutación ofrece ventajas y éstas son apreciadas por el criador o por la "naturaleza", la mutación puede mantenerse y su frecuencia aumentará progresivamente. Si la mutación es neutra, es decir, no es buena ni mala (sólo diferente), su supervivencia será determinada por la deriva genética. Las nuevas mutaciones recesivas se mantienen ocultas de la selección hasta que alcanzan la frecuencia suficiente para que empiecen a aparecer individuos homocigotos. Sin embargo, esto no previene la pérdida de deriva, que no depende del fenotipo.
La deriva es una consecuencia de la naturaleza aleatoria de los acontecimientos genéticos. Por ejemplo, si se aparea una hembra marrón con un macho negro portador de marrón, se espera que una mitad de la progenie sea negra y la otra mitad marrón, pero no nos sorprenderemos demasiado si se obtiene 7 cachorros negros y 3 marrones en una camada de 10. Siempre es así para cada gen que tiene dos o más alelos. Supongamos que solamente tenemos un perro negro (Bb), y el resto son marrones (bb). El perro Bb puede transmitir el alelo B a todos, algunos o ninguno de sus descendientes. Si tiene más de 5 descendientes de color negro, la frecuencia del negro aumentará, si éstos contribuyen de igual forma a la generación siguiente. En las subsiguientes generaciones, esta frecuencia puede derivar a más o a menos.
En una gran población, la frecuencia alélica tenderá a fluctuar solamente en pequeñas proporciones. Sin embargo, las poblaciones pequeñas son intrínsecamente inestables y, si no intervienen otros factores, un alelo acabará por asumir el control. A este fenómeno se le llama fijación. El tiempo que puede tardar, depende del tamaño de la población. Con una raza con pocos individuos, la fijación puede darse fácilmente al cabo de 25 generaciones (~100 años.)
Muchas mutaciones recesivas persisten durante algunas generaciones en bajas proporciones antes de desaparecer. Solamente en muy raras ocasiones alcanzan un nivel significativo en la población (> 1 de 1000). En términos de estimaciones de la diversidad genética basadas en el heterocigotismo medio, estos genes son de hecho monomórficos, como el estudio de 50 o 100 individuos de una población no podrían, en general, revelar diferencias en la mayoría de estos loci. Cuando dos individuos parecen llevar la misma mutación, seguramente sea debido a mutaciones independientes. Sin embargo, a menos que haya una cierta ascendencia común, el riesgo de producir una progenie afectada no será más de un 1 sobre un millón. [Significativamente, en el primer estudio de un "error innato del metabolismo", Garrod (1902) observó que "en las familias en las que los padres no presentaban ellos mismos la anomalía, eran, en un 60 por ciento descendientes de uniones de primos en primer grado." Él estima que solamente un 3% de todas las uniones son entre primos de primer grado.]
Estas estimaciones asumen un protagonismo equivalente de todos los individuos en la población, y ya sabemos que esto no es así. Si un macho reproductor, particularmente productivo o popular produce multiplicado por 10 veces su "parte" de hijos y de hijas, cualquier alelo nocivo que lleve o acarree conseguirá un aumento substancial en la generación siguiente. De un único caso, una nueva mutación puede llegar a ganar una frecuencia moderada. Mientras insistamos en hacer de los apareamientos, una especie de concurso de popularidad, corremos el riesgo de introducir nuevos problemas tan rápidamente como podemos estar haciendo los tests a los antiguos.
"Carga genética" y el efecto fundador
La población humana lleva por lo menos 2500 genes nocivos mutantes (o, más correctamente, alelos de estos genes) causando problemas de salud significativos. La mayor parte se distribuyen bastante uniformemente en la población. Para toda la población de los Canis familiaris, la situación es con toda probabilidad bastante similar. Se estima que cada individuo lleva una carga genética de tres o cuatro alelos lethal-equivalent, significa que si los alelos recesivos se presentaran en forma homocigótica, matarían al portador. Mientras sean recesivos, no deberían causar problemas.
Sin embargo, consideremos qué sucede si formamos una subpoblación eligiendo 10 individuos de una población mucho más grande. Aunque estos individuos no serán portadores de la mayor parte de los alelos recesivos nocivos e indeseados encontrados en la población más grande, los pocos que puedan llevar serán promovidos inmediatamente, de alelos escasos (0.1% o menos), por lo menos al 5% en nuestro ejemplo (o más generalmente, 1/2N, donde N es el número de fundadores).
Ya que la deriva aleatoria tiene un mayor impacto en una población pequeña, la población necesita crecer rápidamente, por lo menos a varios cientos de individuos reproductores, para reducir al mínimo la pérdida de alelos importantes. Durante este tiempo, deberemos seleccionar con suma prudencia. Si bien el fijar un "tipo" es uno de los primeros objetivos de los criadores de perros de raza, una selección demasiado rigurosa durante las primeras generaciones aumenta la posibilidad de la pérdida accidental de algún gen valioso estrechamente ligado a uno de los genes que son objeto de selección. Los Dálmatas, por ejemplo, todos presentan una deficiencia en un enzima necesario para el correcto metabolismo del ácido úrico. El gen mutante parece estar estrechamente ligado a uno de los genes del patrón spotted característico y fue probablemente fijado de forma inadvertida cuando los primeros criadores seleccionaban enfocados a fijar este patrón (Nash, 1990).
Reconocimiento de la mutación
Por tanto, cuando hay una frecuencia alélica del 5%, los individuos afectados deberían representar alrededor del 0.25% de la población, y este sería un buen momento para parar el aumento. ¿Sin embargo, una mutación con esa frecuencia, será reconocida como tal? Si estamos hablando de una raza con un número medio de cuatro a seis pequeños por camada, entonces solamente habrá aproximadamente una camada de cada 100 con un perrito afectado. Si no ha habido otros informes, el criador puede clasificarlo simplemente como "una de esas cosas que pasan". En una raza donde las camadas son más numerosas, la probabilidad que haya dos o más perritos afectados en la misma camada es mayor, pero en estos casos, la falta de intercambio de información entre criadores y la carencia de educación genética puede dar lugar a que no se identifique el problema como un problema genético.
Selección
Una selección no es eficaz si sólo nos ocupamos de fenotipos fácilmente reconocibles. Sin embargo, las mutaciones indeseables no son siempre demasiado corteses. Hay una gama completa de posibilidades que van desde las mutaciones silenciosas, que no tiene ningún efecto sensible sobre las proteínas codificadas, hasta las mutaciones que impiden fabricar cualquier producto funcional. Hay incluso una posibilidad pequeña de mejora. éstas, como las de clase silenciosa, no son ninguna amenaza para nosotros. Sin embargo, las que impiden una función normal pero no la eliminan por completo, muy probablemente sean un problema substancial. Un ejemplo es la mutación del vWD en los Dobermans. Esta mutación elimina el 85-90% del factor de activación de la coagulación, este bajo nivel resulta suficiente para proteger a un individuo afectado, contra el desangrado excesivo en la mayoría de las situaciones. Un perro "afortunado" puede evitar lesiones o una cirugía importante y puede no ser reconocido y puede incluso ser reproductor. Como consecuencia, la frecuencia en la población del alelo mutante es de un poco más del 50% (Brewer, 1999).
Esto no se debe ver como una excepción. Parece que menos de una mutación de cada tres es completamente mortal, y que las otras cubren todo el espectro de una actividad que va del 0 al 100%. Además de ocuparse de un puñado de enfermedades genéticas fácilmente reconocidas en una raza, es probable que se tenga también que administrar decenas de las otras que perjudican el estado de salud pero no presentan un fenotipo claro que se pueda utilizar para identificarlos. ¿Si nos puede pasar por alto un gen que sea solamente funcional en un 10 o un 15%, qué posibilidades tenemos con los que conservan un 80 o 90% de su función normal?
¿Por qué es esto un problema?
En una población pequeña, la deriva conduce inevitablemente a la fijación de un alelo. Las simulaciones informáticas demuestran que si comenzamos con un alelo neutro con una frecuencia del 5% en la población, este sería el caso si lo llevara desde su origen un fundador de cada 10, este será fijado en el 5% de los casos (sorpresa, sorpresa!). Si el valor de adaptación del fenotipo homocigoto disminuye, sus oportunidades de ser el alelo ganador disminuyen. Con una reducción del 5% en el valor de adaptación, un 3'5-4% todavía serán fijos, en 25 generaciones en la mayoría de casos. Con una reducción del 15%, el ordenador dice que el otro alelo ganará casi siempre - si la frecuencia de nuestro alelo levemente nocivo no consigue ningún aumento porque esté ligado a un gen seleccionado o porque sea difundido por un reproductor muy utilizado -. Sin embargo, una o ambas de estas condiciones, son usualmente violadas, según lo discutido arriba. Además, no hay garantía de que nuestra selección discriminará tan finamente como el ordenador.
Si cada gen redujo el valor de adaptación solamente en un 5%, y los efectos son acumulativos, podríamos fácilmente encontrarnos con una población con camadas de tamaños perceptiblemente más bajos, esperanzas de vida reducidas y una mayor susceptibilidad a problemas no genéticos. Con todo no tendríamos ningún gen fácilmente identificable para apuntar con el dedo.
Conclusiones
La longevidad y la fertilidad, consideradas comúnmente como indicadores de la depresión de la cosanguinidad, se reducen en las poblaciones caninas que han sido criadas por apareamientos endogámicos en períodos relativamente cortos (Laikre y Ryman, 1991, Nordrum, 1994). Sin embargo, la mayor parte de la cosanguinidad en las poblaciones de perros domésticos no parece ser debida a los criadores que aparean intencionadamente parientes cercanos[a] (aunque ciertamente hay excepciones), y sí a la pérdida de diversidad debido a la deriva y a la selección. La ausencia de alternativas hace de cada individuo un pariente cercano, independientemente de la estrategia de cría que se emplea.
El resultado para cada raza dependerá de la suerte y de la historia de esta raza. ¿Cuál es el tamaño eficaz de población? ¿Cuántos fundadores había? ¿Durante cuánto tiempo ha sido refinada la raza antes del cierre de los libros de origen? ¿Cuán intensiva fue la selección usada para definir el tipo? ¿Ha habido cuellos de botella? ¿Cuál ha sido el impacto de los reproductores muy utilizados?

¿Qué podemos hacer?
1.    Podemos controlar muchas de las enfermedades genéticas obvias apoyando la investigación que se dedica a la localización de los genes y a desarrollar los tests de ADN para los alelos mutantes. Los resultados de los tests se deben emplear para asegurarse que los portadores solamente se apareen con los individuos exentos de la mutación, más que para la eliminación al por mayor de los portadores, cosa que podría empobrecer todavía más el pool genético.
2.    Podemos explicar a los criadores que las mutaciones existirán siempre, y no son una indicación de fracaso o de mala práctica de cría, y que un intercambio abierto de información es siempre positivo. Podemos también enseñarles formas de alcanzar sus metas personales sin elegir opciones que son perjudiciales a la raza que crían.
3.    Podemos procurar informar a los clubes de raza de la importancia de maximizar la diversidad en el pool genético. Como el principal interventor en la reciente conferencia de AKC/CHF, el Dr. Malcolm Willis, ha subrayado, pocas razas tienen una idea clara de cuáles son sus problemas genéticos más importantes, de la media de perritos por camada, o de la duración de vida media de sus perros. Menos idea todavía tienen de cómo conservar la diversidad existente o reducir la proporción de cosanguinidad.
Notas
[a] Basado en un estudio de pedigríes de 3 y 5 generaciones de Pastores Australianos, de Clumber Spaniels, Standard Poodles y Malamutes.

Por Dr. John Armstrong. Foundation Genetic.

drunken 


 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:38 am

El pedigree como herramienta de cría

El termino Pedigrí (en español) o Pedigree (en inglés) es una palabra antigua quizá utilizada durante los últimos 600 años y deriva del francés “pie de grue” cuyo significado literal es: pie de grulla, posiblemente debido a las líneas horizontales marcadas en la arena por las patas de las grullas y las líneas dibujadas en un inicio posiblemente por criadores de caballos. En efecto el pedigrí fue usado en primera instancia en la cría de ganado, los criadores en la antigüedad habían notado que era difícil recordar la genealogía de los animales y que la consanguinidad llevaba al debilitamiento de su ganado por lo que se inicio con el registro de los animales, su genealogía y de esta manera evitar la consanguinidad. Actualmente, después de más de seis siglos, se continúa la tradición de usarlos como herramienta principal de la cría, y desde luego esto tiene limitaciones (quizá las más) y ventajas. Hemos aprendido a identificar fortalezas en nuestros perros así como debilidades y podemos identificarlas también en sus ancestros de esta manera determinar o conocer la posibilidad de que estas características sean o no heredadas y la frecuencia con la cual lo hacen.
En la actualidad podemos identificar por lo menos 3 tipos de pedigree diferentes y no me refiero al color de las hojas que expide la federación canófila mexicana.
1.-Pedigree tradicional
2.-Pedigree de clasificación por colores
3.-Pedigree con símbolos
El pedigrí tradicional es en efecto el más popular usado entre los criadores y claro tiene grandes limitantes desafortunadamente. Este es el que expiden las federaciones canofilas afiliadas a la FCI. Podemos considerar contiene información pobre de cada animal:
1.-Nombre
2.-Color
3.-Títulos
4.-DNA
Esta es toda la información que contiene, de tal suerte que solo conocemos los nombres y títulos de sus ancestros así como el color. Claro es importante conocer los nombres, afijos y sufijos así sabremos limitadamente de donde proviene nuestro animal aun así esto no es garantía de calidad, es decir cualquier criador reconocido pudiera tener en ocasiones camadas con cachorros de pobres características o hijos de perros de gran renombre que no necesariamente comparten las características físicas o temperamentales con su padre o madre.
El otro punto el color que suele ser fuente de debate y confusión al final por o menos en el bulldog francés he observado que no existe homologación en el concepto y lo que se registra en pedigree no necesariamente se ajusta al estándar racial. Por ejemplo el estándar racial indica que no deben de ser color blanco y es muy frecuente encontrar color: blanco con abigarrado por citar un ejemplo; idealmente debería de ser abigarrado con manchas blancas de “x” extensión. Conceptos como spoted, brindle, cream, fawn, etc. aunque todos sabemos su significado, las federaciones canofilas en países de habla hispana debe de limitarse a utilizar los términos en español para evitar confusiones y tomar siempre de base los colores aceptados para la raza, los cuales deberían estar basado en el “pool” genético para el color de cada raza.
Finalmente los títulos de los ancestros que no necesariamente deben de ser una fiel guía a la hora de elegir progenitores, existen perros muy bellos que tienen hijos muy pobre en cualidades… nuevamente no conocemos las características de los ancestros y no podemos saber si este fue un perro “bello casual” o es bello porque la línea se ha trabajado. Quizá es un campeón pero tiene defectos en la cola y nosotros queremos mejorar la cola en nuestra línea… definitivamente de esta forma no lo lograremos. Para muchos la palabra campeón es sinónimo de calidad absoluta pero no es así, NO hay perros perfectos, se puede ser campeón y tener algunos defectos, los cuales son heredables. Por lo tanto el pedigree solo, como herramienta de cría tiene un valor limitado. Es por eso que se han desarrollado otros tipos de pedigree buscando reducir las limitaciones del pedigree tradicional.
Otro aspecto importante es que este deja a la memoria recordar muchas de las características de nuestros animales.
Otra limitación cuando las cosas marchan bien tanto el criador como el pedigree reciben crédito y cuando las cosas marchan mal simplemente no se registra lo que le quita valor como herramienta de cría, ya que no nos permite aprender de nuestros errores o de errores de otros criadores. Tal vez su mayor limitante es no colectar la información correcta con los suficientes detalles para ser útil en una crianza. En muchas ocasiones su suelen hacer anotaciones en los márgenes del pedigree y se utilizan conceptos como “bonito pelo”, “tipo maravilloso”, “buena arruga”, “buen hueso” todos ellos carentes de valor, debatibles y con significado variable.
Lo que respecta al DNA es un candado mas para evitar “colgar” camadas a “x” o“y” perro, pero como herramienta de cría en este momento carece de valor o significado solo es un código mas de seguridad en el documento conocido como pedigree.
Otros dos pedigrí se han desarrollado para compensar las limitaciones que tiene el pedigrí tradicional. A la primera se le llamó: pedigrí de clasificación de colores. Se enfoca en los rasgos de conformación. El otro se llama: Pedigrí de símbolos, se usa para seguir y analizar la salud, funcionamiento y otros rasgos especiales de interés en cada ejemplar. En los siguientes artículos abordaremos sus características.
Por Dr. Carlos Elizondo.

 drunken
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:45 am

Bulldog Francés – Heredabilidad

En las poblaciones animales silvestres es la naturaleza quien escoge a los reproductores, aquellos con la suficiente fuerza para llegar a la edad adulta y reproducirse. Estos son dignos de perpetuar sus características que lo han hecho llegar hasta este punto de su vida. En los animales domésticos somos nosotros quienes determinamos quienes serán los reproductores. Se supone que esto lo debemos hacer en base al apego racial y de esta manera preservar sus características, tristemente esto no se cumple en todos los casos. Si los perros dejan de ser seleccionados tomará unas cuantas generaciones para que esas características que los hacen especiales es decir que los hacen una raza, se pierdan.
En los artículos previos hemos abordado el tema de la herencia del color en el bulldog francés, debo señalar que puede hacerse extensivo a otras razas con algunos limitantes debido a que solo aborde lo tradicional y reglamentario y tres “curiosidades” como: el color chocolate, azul y black and tan. Hasta este punto hemos hablado de herencia Mendeliana como suele ser llamada, esta suele ser fácil de predecir, es decir, está o no está presente el gen, por ejemplo si cruzamos fawn con máscara negra con fawn con máscara negra es posible predecir que nuestros cachorros serán fawn todos y con máscara negra posiblemente todos (en función de que tengan o no doble copia de este gen), como ven es muy sencillo. A esta modalidad de herencia también suele llamarse  cualitativa, un excelente ejemplo de esto es el color del manto de un frenchie. Por otra parte tenemos a la herencia cuantitativa, esta interviene en aspectos por ejemplo biométricos como el peso y la talla, que por un lado son determinadas genéticamente y por otro son influidas por el medio ambiente.
El concepto de heredabilidad me parece interesante, poder saber que posibilidades hay de que tal o cual característica se herede con X porcentaje de posibilidad resulta atractivo. Se han realizado estimaciones y hay reportes que señalan a la heredabilidad de algunas características en perros, desafortunadamente no hay información concreta para frenchies solo para perros en general, claro que esta puede ser aplicada a frenchies finalmente son una raza de perro.
Pero, ¿cuál es la definición de heredabilidad? es una medida, hace referencia a la intensidad con la que los genes heredados influyen en el fenotipo del perro en cuestión. La heredabilidad suele expresarse de cero a uno. Por ejemplo la heredabilidad del la fertilidad es de  .1–.15, esto debería de ser interpretado de la siguiente forma: la fertilidad de una hembra  está determinada entre un 10–15% por la herencia el restante 85–95% está determinado por factores medio ambientales como el estado de nutrición y la actividad física. De esta forma tenemos características con baja heredabilidad que son ampliamente influidas por factores externos y características de alta heredabilidad que son influidos de forma escasa por factores externos.
A continuación les muestro algunas características y su heredabilidad en porcentaje el resto esta determinado por factores externos como el medio ambiente.

·       Fertilidad 10–15%

·       Tamaño de la camada 10–20%

·       Fisonomía 30–60%

·       Longitud del cuerpo 40%

·       Profundidad del pecho 50%

·       Altura del corvejón 40–60%

·       Nerviosismo 50%

·       Temperamento 30–50%
Podemos hablar de heredabilidad alta cuando es mayor o igual a .5 (50%), heredabilidad media de .2 a .49 (20–49%) y heredabilidad baja menor a .2 (<20%).
Las características son fuertemente influidas por el medio ambiente mas débil es el componente genético por lo que la mejora requiere de mayor atención de los antecedentes familiares. Si por el contrario el componente genético es alto basta realizar una inspección al individuo para obtener un buen resultado.
Recordemos que cada progenitor contribuye con un 50% del material genético de la descendencia, los abuelos con un 25%, los bisabuelos 12.5% y los tatarabuelos con un 6.25%. El porcentaje que aporta alguno de estos cuando se repite en el pedigree  puede ser calculado, pero eso será motivo de otro artículo.
Por Dr. Carlos Elizondo.
drunken 
 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:48 am

Bulldog Francés – Braquicefalia

Cada raza de perros está definida por características morfológicas, carácter, color de manto, muchas veces propias y en ocasiones compartidas. Detrás de cada una de estas características pueden subyacer mutaciones las cuales pueden o no condicionar alteraciones que se asocian problemas de salud en ellas. La braquicefalia es una característica fácilmente reconocida, caracterizada por cráneos amplios y hocicos acortados importantemente.
Razas braquicefalicas como bulldog inglés, bulldog francés, boxer y boston terrier exhiben prognatismo, estas razas fueron seleccionadas así debido a que en su origen algunas de ellas fueros usadas para peleas con toros y osos, bajo el supuesto que esto les confería mordidas más poderosas y mejor “agarre” sin interferir con la respiración, pero esto es harina de otro costal y en otro artículo podremos detallarlo. La realidad es que años de selección han dado por resultado lo que ahora conocemos como las características que definen a cada una de las razas que señale previamente. Estas características también se asocian a problemas de salud, algunas veces muy importantes, entre ellas podemos destacar anormalidades en la respiración, mayor incidencia de golpe de calor, anormalidades de labio y paladar (paladar hendido, ojival, etc.), mayor riesgo de gliomas (tumores en cerebro), hemivértebra, por señalar algunos. Claro algunos con mayor frecuencia en una u otra raza. No olvidemos la incapacidad para reproducirse sin ayuda veterinaria en el caso particular del bulldog ingles los cuales no pueden hacer la monta natural muy frecuentemente y las hembras definitivamente NO pueden parir de forma natural.
No se sabe en qué momento aparecieron los primeros perros braquicefálicos aunque la evidencia arqueológica siguiere su aparición mucho antes que la formación de las razas modernas. La braquicefalia es una condición semi-dominante, existen pocas variaciones entre individuos y esto se acentúo cuando se cerraron “los libros de orígenes” y se inicio con la elaboración de estándares raciales hace poco más de 100 años.
Condición semi-dominante quiere decir que si cruzamos una raza braquicefálica con una no braquicefalica la descendencia mostrara características de braquicefalia de forma intermedia y en diferentes grados (penetrancia variable)
Existe también un síndrome llamado braquicefálico común en estas razas y se caracteriza por: anormalidades respiratorias importantes secundarias a alteraciones en el paladar y en fosas nasales.
Actualmente se realizan investigaciones para dilucidar el gen que confiere la braquicefalia.
Por Dr. Carlos Elizondo.
drunken 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:56 am

La Era del ADN

Mientras los criadores ensayan el ADN, los perros se convierten en conejillos de Indias.

ACORRALANDO A LA NATURALEZA

Cuando los mutantes, los pequeños perritos comienzan a demostrar que pertenecen a camadas de campeones destacándose en las competencias, los criadores de los perros, normalmente invitan a los científicos a que tomen muestras del ADN en los eventos sobre razas en todo el país (EEUU).

Esperan encontrar una causa genética par a esta condición y una manera de mejorar la raza.

Funciona. Los “Magníficos whippets,” que se sabe que son perros grandes, son transformados para que tengan una mutación genética que realce el desarrollo de sus músculos. Y los criadores pueden no desear eliminar el gene de “magnífico” después de todo.

Los científicos encontraron que la misma mutación que alienta a algunos whippets hace,entre otros resultados, que ingrese entre el grupo de los perros más rápidos en pista.

Con una prueba de investigación de ADN en progreso, “vamos a cuidar la velocidad y a perder a los vistosos,” dijo Helena James, criador del whippet en Vancouver , Columbia Británica.

Dejando de lado la mayor par te de de las preocupaciones éticas y las dificultades prácticas asociadas a la práctica de la eugenesia en los seres humanos, los criador es de perros están

adaptando la nueva investigación genética para ejercer el dominio sobre la variación del gen

canino. Las compañías con nombres como Vetgen y Healthgene han comenzado a ofrecer docenas de pruebas de ADN para adaptar el aspecto de los perros, mejorar su salud y, quizás pronto, realzar su comportamiento atlético.

Pero mientras los criadores de perros aplican la precisión científica a su arte histórico, encuentran que la búsqueda para la perfección genética viene con consecuencias imprevistas. Y con la prueba de ADN semejante a la de los seres humanos, las lecciones para intervenir en la naturaleza de los perros pueden intervenir en última instancia tanto en nosotros como sobre nuestros mejores amigos.

Estamos a punto de hacer un giro radical en la forma en que aplicamos la genética en nuestra sociedad, dijo Mark Neff, director del laboratorio de genética veterinaria en la Universidad de California.

“Es mejor enfrentarnos primero con algunas de estas temáticas cuando se refieren a nuestros animales domésticos que cuando se refieren a nosotros.”

Algunos criadores de Labradores están utilizando las pruebas de ADN para obtener un color de pelo plateado y garantizar que tengan aspecto de perros perdigueros exóticos. Los criadores  de Mastines prueban en la obtención de perros lanudos pero evitando que dejen “pelusas”.

Lo próximo, dicen los genetistas, podría ser el hacer pruebas para perros grandes, perros pequeños, perros con pelo corto rizado, los perros con sentidos del olfato más desarrollados y los perros que levantan sus cabezas de manera amenazante cuando les miran.

Los científicos que terminaron recientemente el primer mapa del genoma del perro (de un bóxer llamado Tasha) ahora están solicitando muestras a los dueños de perros a través de todo el mundo para descubrir la base genética para una serie de otros rasgos.

Algunos descubrimientos se desarrollan fuera del ámbito de la investigación financiada por el

gobierno dirigido a mejorar la salud humana. Otros son pagos por los clubes de razas que realizan su misión de mejorar las mismas.

Defendiendo los rasgos deseables e indeseables del ADN de sus perros que pudieran aparecer en sus descendientes, los criador es pueden tomar decisiones más informadas sobre cuales animales reproducir.

Pero como los genes a menudo están vinculados a múltiples rasgos, los científicos advierten, que la selección deliberada, puede a menudo, tornarse negativa. El gen responsable de los Labradores de color plateado, por ejemplo, se vincula a problemas de piel.

 

Con la cortina genética levantada, los criadores también adquieren una carga más pesada sobre las consecuencias de sus opciones. Los criadores de Whippet que continúan reproduciendo rápidamente perros, por ejemplo, ahora a medida que van aprendiendo, a menudo pueden tener que destruir a los “magníficos (bullies)” no deseados como producto de tales apareamientos.

Por otra parte, no se cree en la perspectiva de que las razas de los perros criados intencionalmente puedan tener una ventaja genética que capte la atención de la gente. Alguna vez las capacidades innatas atribuidas a algo místico parecen perder cierta ubicación, una vez que son conectadas con los genes específicos.

Una mutación similar a la que hace que algunos whippets sean más veloces, también existe en los seres humanos: Un eslabón del código genético que regula el desarrollo del músculo, falta.

“Estaría muy bueno hacer ensayos en los finalistas de las Olimpíadas”, dijo Elaine Ostrander,

científica en el National Institutes of Health que descubrió que los whippets más veloces tenían un solo gen de la miostatina, mientras que los “bullies” tenían dos.

“No sabríamos qué hacer con la información,” dijo Ostrander. “¿Vamos a segregar a los atletas que tengan diferentes mutaciones?” Por el momento, son los dueños del whippet que se encuentran en el borde de esta frontera bioética particular.

No son exactamente noticias para los criadores de que la velocidad sea un rasgo heredado: los whippets fueron desarrollados a fines del 1800 específicamente para competición en car reras. Pero sabiendo que uno de sus perros fue engendrado por un portador del gen, dijo Jen Jensen, dueño de un whippet en California, hace que sus campeonatos parezcan “menos ganados.” La sugerencia de la Sra. Jensen de que se requiera una prueba del ADN para todos los perros y que se juzguen los más rápidos sin la mutación y compitan por separado, sin embargo, no ha sido bien recibida.

En una reciente carrera en New Jersey, algunos dueños de whippets deseaban que los poseedor es de la mutación fueran todos eliminados en conjunto, aun cuando quedaran pocos perros rápidos. Pero luego que los perros corrieran tras un señuelo a 35 millas por hora, varios dueños aceptaron que preferirían un whippet con el gen causa de su velocidad.

“Es más divertido tener perros rápidos que perros lentos,” dijo Libby Kirchner, de Glassboro, New Jersey.

Los dolores de cabeza fueron bastantes grandes para algunos criadores que debían tomar

decisiones  sobre la crianza cuando eran dominadas por la intuición y el pedigrí. Seleccionar a un compañero, dicen, significaba implicar un misterio, en cualquier especie.

“Significa que no hay expresión creativa,” dijo Cheryl Shomo, de Chesapeake, Virginia. “Ahora cada uno va a hacer lo obvio.”

Sin embargo, muchos veteranos criadores dan la bienvenida a la transparencia que confieren las pruebas.

Mary Jo Winter s, criador del poodle, usa un ensayo de ADN para color de pelaje de manera de asegurarse que no hay ningún gen para desarrollar el color marrón oscuro al acecho.

“No deseo el marrón,” dijo Winters “No es mi tema.”

Judy Pritchard, criador de Doberman en Toledo, Washington, dice que está considerando criar los perros de forma genéticamente responsable para evitar la enfermedad de von Willibrand, una enfermedad como la hemofilia que también afecta a seres humanos.

Los ensayos de AND, Dijo Pritchard, “son las herramientas más grandes que se han ofrecido para los criadores desde que se comenzaron a criar perros. Necesitan ser utilizados para  mejorar la raza.”

Muchos criadores tienen esperanzas de que este nuevo esfuerzo acorrale la naturaleza para retirar las numerosas enfermedades recesivas que plagan a los perros de pura raza después de generaciones de endogamia impuesta por el humano. Pero algunos cuestionan la sabiduría de la escalada en su intervención. Marque Derr, un autor que ha escrito sobre la historia de la crianza del perro, impulsa a cada uno de nosotros a reconsiderar la meta de la pureza genética.

“Utilizo siempre perros como ejemplo del por qué no deberíamos jugar con nuestro propio
genoma,” dice. “Esta gente está intentando utilizar pruebas de ADN para solucionar problemas de su propia fabricación.”

No obstante, algunos que emplean la paleta del ADN están proponiendo ir incluso más lejos. El Doctor Neff, de la Universidad de California, ha propuesto defender las generaciones  sucesivas de perros con las pruebas de ADN y el criar solamente aquellos con los genes responsables de los rasgos como la detección de la estamina y el olor para crear una nueva raza de perros para patrullar los subterráneos y los aeropuertos. Podría hacerse dentro de algunos años, dijo, en vez de los siglos que tomó a los pastores el criar los guardianes de ovejas que patrullan a sus multitudes.

Incluso los que desean ejercer más control directo sobre el ADN del perro, sin embargo, convienen que ninguna prueba genética puede predecir las cualidades intangibles que hacen de un perro, “un gran perro”.

Si un perro no tiene el espíritu para funcionar en una carrera, no va a ganar, dijo Betsy Browder, dueña de un whippet. ” Le llamamos grandeza,” dijo ella. “Así como no se puede fabricar un atleta humano, si es perezoso, ni todos los genes en el mundo no van a ayudar.”

Por AMY HARMON. Universo Animal.
drunken 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  cocio el Lun Ago 12, 2013 10:59 am


Identificación Genética (ADN)
 



La Real Sociedad Canina de España colabora con el Laboratorio de Genética, Departamento de Producción Animal, Facultad de Veterinaria de la Universidad Complutense de Madrid, para seguir los procedimientos de Identificación Genética Canina de los perros de pura raza inscritos en el Libro de Orígenes Español (L.O.E.) o de los que puedan inscribirse en lo sucesivo, determinando que se utilizarán como referencia los marcadores establecidos en los paneles del I.S.A.G.
Los criadores que quieran realizar las pruebas de identificación genética de sus perros, que deben constar inscritos en el L.O.E. o en un Libro de Orígenes reconocido por la Fédération Cynologique Internationale (F.C.I.), han de solicitarlo a la R.S.C.E., pagando por esta analítica un precio preferente, 36,50 € por analítica realizada, beneficiándose así del convenio existente entre la R.S.C.E. y el Laboratorio de Genética de la F.V.
Los resultados quedarán incorporados a la base de datos de L.O.E., de manera que en los documentos que afecte al perro identificado genéticamente, quedará constancia de ello.
Si el criador precisa de otras pruebas analíticas, deberá consultar precios y condiciones con la R.S.C.E.

[b style="mso-bidi-font-weight: normal;"]- ¿Qué son las pruebas de paternidad o control de filiación?[/b]
La asignación de paternidad se establece cuando un laboratorio utiliza métodos genéticos para demostrar que un supuesto padre es realmente el padre biológico. Las pruebas pueden utilizarse también para excluir la paternidad, es decir, para confirmar que un padre tiene un genotipo incompatible con un supuesto hijo.

[b style="mso-bidi-font-weight: normal;"]- ¿En qué se basan las pruebas de paternidad?[/b]
El análisis del ADN permite conocer el material genético que un individuo ha heredado directamente de sus padres biológicos. El ADN se encuentra en cualquier parte del cuerpo representado de forma idéntica: en la sangre es el mismo que en la piel, músculos, huesos, dientes, etc. El ADN de un animal se crea desde el mismo momento de la concepción y permanece idéntico a lo largo de su vida. Las características genéticas de un individuo deben provenir de sus padres al 50%, de forma que si una marca concreta no proviene de su madre, necesariamente tiene que venir de su padre.

[b style="mso-bidi-font-weight: normal;"]- ¿Cuál es la precisión de las pruebas de ADN?[/b]
La declaración de incompatibilidad entre un padre y un hijo tiene una certeza absoluta (salvo confusiones en las muestras u otros errores no imputables al método), del cien por cien. La asignación de paternidad, sin embargo, tiene asignada una probabilidad que depende del número de porciones de ADN empleadas para la prueba y su fiabilidad puede ser muy superior al 99%.
[b style="mso-bidi-font-weight: normal;"]- ¿Cómo deben recogerse las muestras?[/b]
El análisis se puede hacer a partir de sangre, saliva, pelos u otro material (consúltenos):
[b style="mso-bidi-font-weight: normal;"]A. Sangre*:[/b]
1) Tiene que extraer una cantidad de sangre al animal, entre 1 y 2 ml., dependiendo del tamaño del animal.
2)
Viértala sobre la solución que está contenida en el tubo que le hemos remitido**, cierre el tubo y mezcle invirtiendo cuidadosamente el tubo dos o tres veces.
3)
Anote la identificación del animal en el lateral del tubo.
4)
Rellene la hoja de datos y corte por la línea de puntos.
5)
Remítanos la muestra a las señas que aparecen indicadas en esa hoja, a temperatura ambiente por correo ordinario o por mensajería, sin olvidar adjuntar la hoja de datos.
[b style="mso-bidi-font-weight: normal;"]B. Saliva:[/b]
1) Utilice un hisopo de algodón que puede adquirir en una farmacia y después de extraerlo de su funda trate de frotar el algodón del hisopo durante medio minuto por la zona en la que el labio del perro se une a su mandíbula (es preferible que el animal no se haya alimentado recientemente).
2) Si ha recibido tubos con conservante de ADN de nuestro laboratorio simplemente introduzca el hisopo en el tubo con dicho conservante y siga los pasos 3 al 5 del apartado anterior. En el caso de no disponer de nuestro conservante tiene que dejar secar el algodón durante 1 hora antes de introducirlo en su funda y mantenerlo en el frigorífico hasta que nos remita la muestra siguiendo los pasos 3 a 5 del apartado anterior.
[b style="mso-bidi-font-weight: normal;"]C. Pelos:[/b]
1) Es necesario que los pelos que nos remitan tengan bulbo. En general no son utilizables los pelos desprendidos o mudados.
2)
Si ha recibido tubos con conservante de ADN** de nuestro laboratorio simplemente introduzca los pelos de manera que se garantice que el bulbo queda bañado por el conservante y siga los pasos 3 a 5 de los apartados anteriores. En el caso de no disponer de conservante introduzca los pelos de cada uno de los animales en un sobre de papel y siga los pasos 3 a 5.
* La ventaja de recibir sangre es la facilidad para mantener un banco de ADN que puede ser utilizado para otros análisis genéticos de su interés en el futuro. La cantidad de ADN disponible en 2 ml de sangre es muy superior a la que podemos obtener de la saliva.
** Solicite que le enviemos tubos con conservante de ADN para recogida de muestras, tiene la ventaja de conservar el ADN sin necesidad de refrigeración durante tiempo indefinido y poder enviar las muestras sin urgencia.
IMPORTANTE:
     NUNCA CONGELE la muestra.
     No necesita refrigerarla si la muestra se conserva en el producto que le hemos proporcionado.
     En caso de que la remisión no sea inmediata, o se trate de saliva, mantenga preferentemente el tubo en el frigorífico a 4-6ºC.

PRECIOS:
     La R.S.C.E. le cobrará 36,50 € por los costes de los análisis genéticos y la inclusión en su base de datos de los genotipos de sus muestras.
     Algunos análisis especiales solicitados por usted pueden llevar un recargo (9 €) que le serán debidamente justificados.
ANÁLISIS A REALIZAR:
     Identificación genética
     Control de filiación o de paternidad:
     Para llevar a cabo análisis de filiación tendrá, en la hoja de datos, que dejar claro cuál de las muestras corresponde al padre, cuál a la madre y cuál o cuáles a los hijos a contrastar.
[b style="mso-bidi-font-weight: normal;"]- ¿Son confidenciales los resultados de las pruebas de paternidad?[/b]
Sí, los resultados son estrictamente confidenciales para la(s) persona(s) o entidad que haya solicitado las pruebas.
[b style="mso-bidi-font-weight: normal;"]
- ¿Puede realizarse la prueba de paternidad sin la muestra de uno de los padres?
[/b]
Sí, aunque requiere un tiempo adicional para establecer el resultado al ser necesario utilizar un mayor número de marcadores con el fin de mantener una elevada potencia de discriminación, por lo que es altamente recomendable encontrar la forma de obtener muestras de ambos padres.
Fuente Real Sociedad Canina de España.
drunken 

 
avatar
cocio
Usuari@ Veteran@
Usuari@ Veteran@

Mensajes : 12201
Localización : PALMA DE MALLORCA

Volver arriba Ir abajo

Re: GENÉTICA - EMPEZANDO POR EL PRINCIPIO

Mensaje  Contenido patrocinado


Contenido patrocinado


Volver arriba Ir abajo

Ver el tema anterior Ver el tema siguiente Volver arriba

- Temas similares

 
Permisos de este foro:
No puedes responder a temas en este foro.